or
or
Exact

Results for "COL19A1"

Variant Events: 20

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
COL19A1     11409.p1chr6:
70637786-70637786
GTintronicDe novo--Iossifov2014 E
Kosmicki2017 E
Satterstrom2020 E
COL19A1     1-0025-004chr6:
70868622-70868622
TAintronicDe novo--Yuen2017 G
COL19A1     2-0198-004chr6:
70582496-70582496
TAintronicDe novo--Yuen2017 G
COL19A1     2-1702-003chr6:
70750076-70750076
TCintronicDe novo--Yuen2017 G
COL19A1     03HI2508Achr6:
70847641-70847641
TGsplicingsplicing19.91-Doan2019 E
COL19A1     03HI2508Achr6:
70733517-70733517
ATsplicingsplicing20.7-Doan2019 E
COL19A1     08C75209chr6:
70639589-70639589
GTexonicDe novosynonymous SNVNM_001858c.G663Tp.V221V--Satterstrom2020 E
COL19A1     2-0198-005chr6:
70582496-70582496
TAintronicDe novo--Yuen2017 G
COL19A1     09C84588chr6:
70608807-70608807
CTintronicDe novo--Satterstrom2020 E
COL19A1     iHART1237chr6:
70854808-70854808
AGsplicingPaternalsplicing14.281.0E-4Ruzzo2019 G
COL19A1     iHART1538chr6:
70847641-70847641
TGsplicingPaternalsplicing19.91-Ruzzo2019 G
COL19A1     AU4056301chr6:
70599760-70599760
GCintronicDe novo--Yuen2017 G
COL19A1     AU4056301chr6:
70599762-70599762
GCintronicDe novo--Yuen2017 G
COL19A1     AU3874302chr6:
70686131-70686139
CGTCTGTCTCGTCTGTCTGTCTintronicDe novo--Yuen2017 G
COL19A1     A13chr6:
70588467-70588467
CGintronicDe novo--Wu2018 G
COL19A1     1-0447-003chr6:
70866386-70866406
GGAGAGAGAGAGAGAGAGAGAGGAGAGAGAGAGAGAGAGAintronicDe novo--Yuen2017 G
COL19A1     1-0458-003chr6:
70772898-70772898
CAintronicDe novo--Yuen2017 G
COL19A1     AU4145303chr6:
70587349-70587349
GAintronicDe novo--Yuen2017 G
COL19A1     1-0551-004chr6:
70606542-70606545
CTCACintronicDe novo--Yuen2017 G
COL19A1     F10129-4chr6:
70854933-70854933
GCintronicDe novo-4.368E-5Satterstrom2020 E
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More