or
or
Exact

Results for "CSMD3"

Variant Events: 174

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
CSMD3     AU4069302chr8:
115415732-115415732
TCintergenicDe novo--Yuen2017 G
CSMD3     2-1619-004chr8:
116173652-116173652
AGintergenicDe novo--Yuen2017 G
CSMD3     74-0355chr8:
113447649-113447649
TCintronicDe novo--Michaelson2012 G
CSMD3     Li2017:20746chr8:
113308208-113308208
AGexonicUnknownnonsynonymous SNVNM_052900
NM_198123
NM_198124
c.T7961C
c.T8468C
c.T8348C
p.I2654T
p.I2823T
p.I2783T
21.61.0E-4Li2017 T
CSMD3     AU2756306chr8:
113348872-113348872
CTintronicDe novo--Yuen2017 G
CSMD3     AU2793302chr8:
114744925-114744925
TCintergenicDe novo--Yuen2017 G
CSMD3     2-0285-004chr8:
115823590-115823590
AAGAAAATATCTAAGGCAATTintergenicDe novo--Yuen2017 G
CSMD3     AU4145301chr8:
116159407-116159407
CAintergenicDe novo--Yuen2017 G
CSMD3     AU4234302chr8:
113346541-113346541
TCintronicDe novo--Yuen2017 G
CSMD3     1-0871-003chr8:
114951544-114951544
CTintergenicDe novo--Yuen2017 G
CSMD3     AU031403chr8:
113673736-113673736
ACintronicDe novo--Yuen2017 G
CSMD3     1-0175-003chr8:
114312361-114312361
TCintronicDe novo--Yuen2017 G
CSMD3     2-1511-003chr8:
114335669-114335669
TCintronicDe novo--Yuen2017 G
CSMD3     3-0169-000chr8:
115108564-115108564
TCintergenicDe novo--Yuen2016 G
CSMD3     2-0319-003chr8:
115260951-115260951
CAintergenicDe novo--Yuen2017 G
CSMD3     5-0045-003chr8:
115315719-115315720
TGTintergenicDe novo--Yuen2017 G
CSMD3     1-0006-004chr8:
113514374-113514374
AGintronicDe novo--Yuen2017 G
CSMD3     1-0196-005chr8:
113753647-113753647
TCintronicDe novo--Yuen2017 G
CSMD3     1-0377-003chr8:
115765552-115765552
TTAintergenicDe novo--Yuen2017 G
CSMD3     AU3712302chr8:
115064269-115064269
GTintergenicDe novo--Yuen2017 G
CSMD3     A20chr8:
113668409-113668409
TCexonicDe novononsynonymous SNVNM_052900
NM_198123
NM_198124
c.A2666G
c.A2978G
c.A2858G
p.N889S
p.N993S
p.N953S
13.642.487E-5Wu2018 G
CSMD3     AU072004chr8:
114288084-114288084
ATintronicDe novo--Yuen2017 G
CSMD3     A17chr8:
113668564-113668564
CGexonicDe novononsynonymous SNVNM_052900
NM_198123
NM_198124
c.G2511C
c.G2823C
c.G2703C
p.Q837H
p.Q941H
p.Q901H
12.4-Wu2018 G
CSMD3     2-1526-003chr8:
115370446-115370446
CAintergenicDe novo--Yuen2017 G
CSMD3     A1chr8:
113516066-113516066
CTexonicDe novononsynonymous SNVNM_052900
NM_198123
NM_198124
c.G4724A
c.G5036A
c.G4916A
p.R1575Q
p.R1679Q
p.R1639Q
28.08.254E-6Wu2018 G
CSMD3     AU011903chr8:
113580313-113580313
GCintronicDe novo--Yuen2017 G
CSMD3     A23chr8:
113349801-113349801
TGexonicDe novononsynonymous SNVNM_052900
NM_198123
NM_198124
c.A6500C
c.A6812C
c.A6692C
p.N2167T
p.N2271T
p.N2231T
22.0-Wu2018 G
CSMD3     A18chr8:
113651035-113651035
GAexonicDe novononsynonymous SNVNM_052900
NM_198123
NM_198124
c.C3104T
c.C3416T
c.C3296T
p.S1035L
p.S1139L
p.S1099L
23.7-Wu2018 G
CSMD3     2-1086-003chr8:
116351873-116351873
GAintergenicDe novo--Yuen2017 G
CSMD3     AU4089302chr8:
115239646-115239650
CATATCATintergenicDe novo--Yuen2017 G
CSMD3     1-0218-003chr8:
113421647-113421647
CTintronicDe novo--Yuen2017 G
CSMD3     1-0352-005chr8:
114108571-114108571
TAintronicDe novo--Yuen2017 G
CSMD3     A3chr8:
113323314-113323314
CTexonicDe novononsynonymous SNVNM_052900
NM_198123
NM_198124
c.G7466A
c.G7778A
c.G7658A
p.R2489H
p.R2593H
p.R2553H
19.341.648E-5Wu2018 G
CSMD3     2-1339-003chr8:
113738639-113738639
AAGTintronicDe novo--Yuen2017 G
CSMD3     2-0242-005chr8:
114222192-114222194
ACTAintronicDe novo--Yuen2017 G
CSMD3     2-1526-003chr8:
115385361-115385361
GCintergenicDe novo--Yuen2017 G
CSMD3     AU3680302chr8:
115801016-115801016
AGintergenicDe novo--Yuen2017 G
CSMD3     AU0540301chr8:
115757303-115757303
TGintergenicDe novo--Yuen2017 G
CSMD3     2-0158-003chr8:
114699833-114699833
CTintergenicDe novo--Yuen2017 G
CSMD3     1-0627-004chr8:
114355226-114355226
GAintronicDe novo--Yuen2017 G
CSMD3     2-1364-003chr8:
113344533-113344534
AGAintronicDe novo--Yuen2017 G
CSMD3     1-0440-003chr8:
114756214-114756214
GAintergenicDe novo--Yuen2017 G
CSMD3     1-0119-004chr8:
113276381-113276381
CTintronicDe novo--Yuen2017 G
CSMD3     AU3763305chr8:
116026060-116026060
CTintergenicDe novo--Yuen2017 G
CSMD3     5-0064-003chr8:
116054625-116054630
CTTTTTCTTTTTTintergenicDe novo--Yuen2017 G
CSMD3     2-1220-003chr8:
115592593-115592593
GAintergenicDe novo--Yuen2017 G
CSMD3     AU3912301chr8:
116132835-116132847
TGTCTCAAATTAATintergenicDe novo--Yuen2017 G
CSMD3     1-0563-004chr8:
115744910-115744910
CTintergenicDe novo--Yuen2017 G
CSMD3     7-0002-003chr8:
114783478-114783478
CAintergenicDe novo--Yuen2017 G
CSMD3     AU4154303chr8:
113823079-113823079
CAintronicDe novo--Yuen2017 G
CSMD3     08C72821chr8:
113254051-113254051
GCintronicDe novo--Satterstrom2020 E
CSMD3     1-0671-003chr8:
115045114-115045114
TGintergenicDe novo--Yuen2017 G
CSMD3     1-0862-003chr8:
115574879-115574879
CTintergenicDe novo--Yuen2017 G
CSMD3     AU2495302chr8:
115663125-115663125
GAintergenicDe novo--Yuen2017 G
CSMD3     1-0460-003chr8:
113984351-113984351
ACintronicDe novo--Yuen2017 G
CSMD3     AU017304chr8:
115616798-115616798
GCintergenicDe novo--Yuen2017 G
CSMD3     1-0388-003chr8:
113922765-113922765
CTintronicDe novo--Yuen2017 G
CSMD3     1-0443-003chr8:
114029443-114029443
GAintronicDe novo--Yuen2016 G
CSMD3     AU024104chr8:
114388649-114388654
TAACAATAAintronicDe novo--Yuen2017 G
CSMD3     2-0110-003chr8:
113654825-113654825
CTintronicDe novo--Yuen2016 G
Yuen2017 G
CSMD3     1-0460-003chr8:
114590621-114590621
AGintergenicDe novo--Yuen2017 G
CSMD3     2-1505-004chr8:
114227293-114227293
TCintronicDe novo--Yuen2017 G
CSMD3     A5chr8:
114552458-114552458
CTintergenicDe novo--Wu2018 G
CSMD3     A9chr8:
113354303-113354303
AGintronicDe novo--Wu2018 G
CSMD3     A15chr8:
114538242-114538242
CTintergenicDe novo--Wu2018 G
CSMD3     1-0636-003chr8:
115325200-115325200
TGintergenicDe novo--Yuen2017 G
CSMD3     1-0065-005chr8:
113645498-113645498
AGintronicDe novo--Yuen2017 G
CSMD3     1-0289-003chr8:
116074360-116074360
AATATATACATintergenicDe novo--Yuen2017 G
CSMD3     AU031203chr8:
115588781-115588781
GTintergenicDe novo--Yuen2017 G
CSMD3     1-0289-003chr8:
114662623-114662623
TCintergenicDe novo--Yuen2017 G
CSMD3     A10chr8:
116051582-116051585
ATGTAintergenicDe novo--Wu2018 G
CSMD3     1-0609-003chr8:
114626510-114626510
CTintergenicDe novo--Yuen2017 G
CSMD3     7-0082-003chr8:
116325260-116325260
CTintergenicDe novo--Yuen2017 G
CSMD3     5-0015-004chr8:
115309020-115309020
TAintergenicDe novo--Yuen2017 G
CSMD3     1-0384-003chr8:
115449241-115449264
GTATTTTTATTTTATTTTTATTTTGTATTTTTATTTTintergenicDe novo--Yuen2017 G
CSMD3     AU4269301chr8:
115807113-115807113
CTintergenicDe novo--Yuen2017 G
CSMD3     3-0307-000chr8:
114167005-114167005
AGintronicDe novo--Yuen2017 G
CSMD3     09C81416chr8:
113308259-113308259
TCintronicDe novo--Kosmicki2017 E
CSMD3     AU072505chr8:
115848239-115848239
ATintergenicDe novo--Yuen2017 G
CSMD3     2-0126-004chr8:
114330942-114330942
CGintronicDe novo--Yuen2017 G
CSMD3     AU3913302chr8:
114810313-114810313
CGintergenicDe novo--Yuen2017 G
CSMD3     AU031404chr8:
114402801-114402806
CATGATCATintronicDe novo--Yuen2017 G
CSMD3     AU3782303chr8:
114346612-114346612
TCintronicDe novo--Yuen2017 G
CSMD3     1-0352-003chr8:
114108571-114108571
TAintronicDe novo--Yuen2016 G
CSMD3     2-0057-004chr8:
113706837-113706837
AGintronicDe novo--Yuen2017 G
CSMD3     2-1693-003chr8:
113281070-113281070
CTintronicDe novo--Yuen2017 G
CSMD3     A08036-1chr8:
113358413-113358413
TAexonicUnknownnonsynonymous SNVNM_052900
NM_198123
NM_198124
c.A6043T
c.A6355T
c.A6235T
p.S2015C
p.S2119C
p.S2079C
25.79.065E-5Li2017 T
CSMD3     AU3368302chr8:
113945072-113945072
TAintronicDe novo--Yuen2017 G
CSMD3     5-0055-004chr8:
115196343-115196343
TCintergenicDe novo--Yuen2017 G
CSMD3     AU3368302chr8:
114479023-114479023
ACintergenicDe novo--Yuen2017 G
CSMD3     AU060403chr8:
113284933-113284933
TCintronicDe novo--Yuen2017 G
CSMD3     2-1444-003 Complex Event; expand row to view variants  De novo--Yuen2016 G
Yuen2017 G
CSMD3     2-1352-003chr8:
114792229-114792229
GAintergenicDe novo--Yuen2017 G
CSMD3     2-0307-003chr8:
114197048-114197049
ACAintronicDe novo--Yuen2017 G
CSMD3     AU4015302chr8:
114028710-114028710
AGintronicDe novo--Yuen2017 G
CSMD3     AU4159301chr8:
114656499-114656499
TCintergenicDe novo--Yuen2017 G
CSMD3     11194.p1chr8:
113640534-113640534
ATintronicDe novo--Turner2016 G
CSMD3     AU043804chr8:
114276274-114276274
TAintronicDe novo--Yuen2017 G
CSMD3     13023.p1chr8:
114944965-114944965
TCintergenicDe novo--Turner2016 G
CSMD3     1-0403-004chr8:
114837692-114837692
TGintergenicDe novo--Yuen2017 G
CSMD3     1-0673-003chr8:
114256171-114256171
ACintronicDe novo--Yuen2017 G
CSMD3     2-1275-003chr8:
115758031-115758031
GAintergenicDe novo--Yuen2017 G
CSMD3     AU3997301chr8:
114732085-114732085
GCintergenicDe novo--Yuen2017 G
CSMD3     2-1487-003chr8:
114524476-114524476
CTintergenicDe novo--Yuen2017 G
CSMD3     AU3730301chr8:
114486813-114486813
CAintergenicDe novo--Yuen2017 G
CSMD3     11352.p1chr8:
113812431-113812431
GAexonicDe novosynonymous SNVNM_052900
NM_198123
NM_198124
c.C1620T
c.C1932T
c.C1812T
p.D540D
p.D644D
p.D604D
-0.0017Iossifov2014 E
Kosmicki2017 E
CSMD3     1-0139-005chr8:
113695613-113695613
AGintronicDe novo--Yuen2017 G
CSMD3     AU1987302chr8:
115840416-115840416
TCintergenicDe novo--Yuen2017 G
CSMD3     1-0289-004chr8:
115311671-115311671
TCintergenicDe novo--Yuen2017 G
CSMD3     1-0572-003chr8:
114954698-114954698
AGintergenicDe novo--Yuen2017 G
CSMD3     1-0265-003chr8:
114806321-114806321
TGintergenicDe novo--Yuen2017 G
CSMD3     2-1389-003chr8:
115895873-115895873
AGintergenicDe novo--Yuen2016 G
Yuen2017 G
CSMD3     Li2017:19661chr8:
113960052-113960052
GTexonicUnknownnonsynonymous SNVNM_052900
NM_198123
NM_198124
c.C1163A
c.C1475A
c.C1355A
p.P388Q
p.P492Q
p.P452Q
18.65-Li2017 T
CSMD3     2-1371-003chr8:
115342779-115342779
AGintergenicDe novo--Yuen2016 G
Yuen2017 G
CSMD3     1-0382-004chr8:
116022425-116022425
GCintergenicDe novo--Yuen2017 G
CSMD3     1-0969-003chr8:
115595487-115595487
CTintergenicDe novo--Yuen2017 G
CSMD3     2-1207-003chr8:
115055952-115055952
ACintergenicDe novo--Yuen2017 G
CSMD3     2-0208-004chr8:
114894978-114894978
ACintergenicDe novo--Yuen2017 G
CSMD3     2-1237-003chr8:
115596703-115596703
GAintergenicDe novo--Yuen2017 G
CSMD3     1-0706-003chr8:
113684628-113684628
TCintronicDe novo--Yuen2017 G
CSMD3     1-0339-003chr8:
115965775-115965775
CAintergenicDe novo--Yuen2017 G
CSMD3     2-1460-003chr8:
113908928-113908928
GAintronicDe novo--Yuen2017 G
CSMD3     2-1196-003chr8:
116280902-116280902
ACintergenicDe novo--Yuen2016 G
Yuen2017 G
CSMD3     SJD_49chr8:
113599372-113599372
TGexonicMaternalnonsynonymous SNVNM_052900
NM_198123
NM_198124
c.A3496C
c.A3808C
c.A3688C
p.S1166R
p.S1270R
p.S1230R
14.229.091E-5Toma2013 E
CSMD3     3-0080-000chr8:
116194513-116194513
TCintergenicDe novo--Yuen2017 G
CSMD3     AU2109302chr8:
113996724-113996724
CTintronicDe novo--Yuen2017 G
CSMD3     2-1292-004chr8:
115096625-115096625
GAintergenicDe novo--Yuen2017 G
CSMD3     7-0149-003chr8:
114250028-114250028
GAintronicDe novo--Yuen2017 G
CSMD3     5-0042-003chr8:
114388959-114388965
ATATCTAATATCTATCTAsplicingDe novosplicing--Yuen2017 G
CSMD3     AU1668302chr8:
113624235-113624235
CTintronicDe novo--Yuen2017 G
CSMD3     AU3907301chr8:
114765555-114765555
CTintergenicDe novo--Yuen2017 G
CSMD3     1-0332-003chr8:
113449093-113449093
TCintronicDe novo--Yuen2017 G
CSMD3     AU1668302chr8:
114695200-114695200
ACintergenicDe novo--Yuen2017 G
CSMD3     2-0242-004chr8:
114721487-114721487
CCTintergenicDe novo--Yuen2017 G
CSMD3     AU4015303chr8:
114062285-114062285
TCintronicDe novo--Yuen2017 G
CSMD3     1-0180-004chr8:
113657507-113657507
TAintronicDe novo--Yuen2017 G
CSMD3     AU074503chr8:
115168175-115168175
CTintergenicDe novo--Yuen2017 G
CSMD3     AU4263304chr8:
113874426-113874426
TAintronicDe novo--Yuen2017 G
CSMD3     1-0121-003chr8:
114962354-114962354
GAintergenicDe novo--Yuen2017 G
CSMD3     1-0570-003chr8:
113924969-113924969
TCintronicDe novo--Yuen2017 G
CSMD3     AU4168306chr8:
113459195-113459195
AGintronicDe novo--Yuen2017 G
CSMD3     2-0003-003chr8:
114312369-114312369
TCintronicDe novo--Yuen2017 G
CSMD3     1-0490-003chr8:
113905346-113905368
AACTACTACTACTACTACTACTAAACTACTACTACTACTACTAintronicDe novo--Yuen2017 G
CSMD3     AU2000305chr8:
113552123-113552123
CTintronicDe novo--Yuen2017 G
CSMD3     AU3720302chr8:
115534977-115534977
CTintergenicDe novo--Yuen2017 G
CSMD3     2-0299-005chr8:
116022276-116022276
GAintergenicDe novo--Yuen2017 G
CSMD3     AU4153301chr8:
114532162-114532162
CTintergenicDe novo--Yuen2017 G
CSMD3     5-0146-003chr8:
113874561-113874561
GAintronicDe novo--Yuen2017 G
CSMD3     AU0638302chr8:
116227168-116227168
TCintergenicDe novo--Yuen2017 G
CSMD3     1-0514-003chr8:
114584310-114584310
AGintergenicDe novo--Yuen2016 G
Yuen2017 G
CSMD3     2-1567-003chr8:
114098651-114098651
GAintronicDe novo--Yuen2017 G
CSMD3     2-1314-003chr8:
114189684-114189684
GTintronicDe novo--Yuen2016 G
CSMD3     2-1246-003chr8:
115127504-115127504
CTintergenicDe novo--Yuen2017 G
CSMD3     3-0437-000chr8:
113393529-113393529
AATintronicDe novo--Yuen2016 G
CSMD3     1-0757-003chr8:
114768770-114768770
ACintergenicDe novo--Yuen2017 G
CSMD3     2-0012-003chr8:
116018086-116018086
CAintergenicDe novo--Yuen2017 G
CSMD3     AU015903chr8:
113924276-113924276
ATintronicDe novo--Yuen2017 G
CSMD3     G01-GEA-312-HIchr8:
113504881-113504881
GAexonicDe novosynonymous SNVNM_052900
NM_198123
NM_198124
c.C4803T
c.C5115T
c.C4995T
p.G1601G
p.G1705G
p.G1665G
--Satterstrom2020 E
CSMD3     08C72543chr8:
113347613-113347613
TAexonicDe novosynonymous SNVNM_052900
NM_198123
NM_198124
c.A6798T
c.A7110T
c.A6990T
p.L2266L
p.L2370L
p.L2330L
--Satterstrom2020 E
CSMD3     AU4067301chr8:
116413473-116413473
TAintergenicDe novo--Yuen2017 G
CSMD3     1-0158-012chr8:
114774444-114774444
TCintergenicDe novo--Yuen2017 G
CSMD3     1-0699-003chr8:
115613552-115613552
TCintergenicDe novo--Yuen2017 G
CSMD3     JASD_Fam0095chr8:
113649210-113649210
TAexonicDe novononsynonymous SNVNM_052900
NM_198123
NM_198124
c.A3239T
c.A3551T
c.A3431T
p.D1080V
p.D1184V
p.D1144V
24.4-Takata2018 E
CSMD3     1-0885-003chr8:
114066027-114066027
AATATintronicDe novo--Yuen2017 G
CSMD3     2-0323-003chr8:
114722334-114722334
CTintergenicDe novo--Yuen2017 G
CSMD3     AU002406chr8:
115176890-115176890
GAintergenicDe novo--Yuen2017 G
CSMD3     1-0553-003chr8:
115089679-115089679
GAintergenicDe novo--Yuen2017 G
CSMD3     1-0772-003chr8:
115884381-115884381
TCintergenicDe novo--Yuen2017 G
CSMD3     2-1619-004chr8:
113736080-113736080
ACintronicDe novo--Yuen2017 G
CSMD3     AU072504chr8:
113303531-113303531
GAintronicDe novo--Yuen2017 G
CSMD3     1-0051-005chr8:
115363688-115363688
CTintergenicDe novo--Yuen2017 G
CSMD3     1-0568-003chr8:
114346140-114346140
CGintronicDe novo--Yuen2017 G
CSMD3     AU3874302chr8:
115699869-115699869
ATintergenicDe novo--Yuen2017 G
CSMD3     3-0430-000chr8:
114743552-114743552
GAintergenicDe novo--Yuen2016 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More