or
or
Exact

Results for "LINC01392"

Variant Events: 43

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
LINC01392     7-0249-004chr7:
115326825-115326825
GTintergenicDe novo--Yuen2017 G
LINC01392     3-0458-000Bchr7:
114954006-114954006
GAintergenicDe novo--Yuen2017 G
LINC01392     2-1138-003chr7:
115546150-115546150
AGintergenicDe novo--Yuen2017 G
LINC01392     2-1132-003chr7:
115057173-115057173
TAintergenicDe novo--Yuen2017 G
LINC01392     AU061003chr7:
115080399-115080399
TGintergenicDe novo--Yuen2017 G
LINC01392     2-1429-003chr7:
115101703-115101703
CTintergenicDe novo--Yuen2017 G
LINC01392     AU061003chr7:
115494963-115494963
CAintergenicDe novo--Yuen2017 G
LINC01392     2-1436-003chr7:
115392860-115392860
GCintergenicDe novo--Yuen2017 G
LINC01392     3-0458-000chr7:
114954006-114954006
GAintergenicDe novo--Yuen2016 G
LINC01392     1-0294-003chr7:
115301785-115301785
ACintergenicDe novo--Yuen2016 G
Yuen2017 G
LINC01392     2-1086-003chr7:
115112949-115112949
TTAintergenicDe novo--Yuen2017 G
LINC01392     AU3451301chr7:
115232541-115232541
GAintergenicDe novo--Yuen2017 G
LINC01392     AU069603chr7:
115520726-115520726
CTintergenicDe novo--Yuen2017 G
LINC01392     AU079605chr7:
115425330-115425330
GAintergenicDe novo--Yuen2017 G
LINC01392     1-0403-003chr7:
114989303-114989303
GAintergenicDe novo--Yuen2017 G
LINC01392     AU015903chr7:
115498033-115498033
ATintergenicDe novo--Yuen2017 G
LINC01392     1-0272-004chr7:
115072476-115072476
GCintergenicDe novo--Yuen2017 G
LINC01392     63-449chr7:
114776336-114776336
CTncRNA_intronicDe novo--Michaelson2012 G
LINC01392     7-0249-003chr7:
115326158-115326176
CATCTATCTATCTATCTATCATCTATCTATCTATintergenicDe novo--Yuen2017 G
LINC01392     1-0358-003chr7:
115052201-115052201
CGintergenicDe novo--Yuen2017 G
LINC01392     AU3862305chr7:
114924923-114924923
AGintergenicDe novo--Yuen2017 G
LINC01392     1-0380-003chr7:
114915831-114915831
AGintergenicDe novo--Yuen2017 G
LINC01392     AU2381302chr7:
115279690-115279690
GAintergenicDe novo--Yuen2017 G
LINC01392     1-0209-003chr7:
115060199-115060199
CAintergenicDe novo--Yuen2017 G
LINC01392     AU4150301chr7:
115424407-115424407
CGintergenicDe novo--Yuen2017 G
LINC01392     1-0259-005chr7:
115440774-115440774
GCintergenicDe novo--Yuen2017 G
LINC01392     3-0458-000Achr7:
114954006-114954006
GAintergenicDe novo--Yuen2017 G
LINC01392     2-1592-003chr7:
115312602-115312602
GCintergenicDe novo--Yuen2017 G
LINC01392     2-0171-003chr7:
114776400-114776400
CAncRNA_intronicDe novo--Yuen2017 G
LINC01392     1-0972-003chr7:
115097740-115097740
ATintergenicDe novo--Yuen2017 G
LINC01392     AU1764301chr7:
115431929-115431929
AGintergenicDe novo--Yuen2017 G
LINC01392     AU4327303chr7:
115385785-115385788
ATCTATintergenicDe novo--Yuen2017 G
LINC01392     AU3861301chr7:
115426643-115426644
CACAAintergenicDe novo--Yuen2017 G
LINC01392     AU2129303chr7:
115270435-115270435
AGintergenicDe novo--Yuen2017 G
LINC01392     AU4154303chr7:
115363314-115363316
AGGAGintergenicDe novo--Yuen2017 G
LINC01392     A14chr7:
114848153-114848153
TCncRNA_intronicDe novo--Wu2018 G
LINC01392     1-0359-003chr7:
114889800-114889800
TAintergenicDe novo--Yuen2017 G
LINC01392     1-0720-003chr7:
115016960-115016960
TCintergenicDe novo--Yuen2017 G
LINC01392     2-1116-003chr7:
115449467-115449482
AACACACACACACACAAACACACACACACAintergenicDe novo--Yuen2017 G
LINC01392     2-1633-003chr7:
115143395-115143395
TAintergenicDe novo--Yuen2017 G
LINC01392     1-0595-005chr7:
114999326-114999326
TCintergenicDe novo--Yuen2017 G
LINC01392     1-0125-003chr7:
114838339-114838339
AGncRNA_intronicDe novo--Yuen2017 G
LINC01392     2-1178-003chr7:
114958060-114958061
AGAintergenicDe novo--Yuen2016 G
Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More