or
or
Exact

Results for "MIR6085"

Variant Events: 16

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
MIR6085     1-0169-004chr15:
62824361-62824361
GAintergenicDe novo--Yuen2017 G
MIR6085     1-0203-003chr15:
62636904-62636904
CAintergenicDe novo--Yuen2017 G
MIR6085     3-0307-000chr15:
62761788-62761788
TAintergenicDe novo--Yuen2017 G
MIR6085     1-0465-003chr15:
62803436-62803436
GAintergenicDe novo--Yuen2017 G
MIR6085     1-0998-003chr15:
62663121-62663138
GTAATAATAATAATAATAGTAATAATAATAATAintergenicDe novo--Yuen2017 G
MIR6085     1-0345-003chr15:
62762997-62762997
AGintergenicDe novo--Yuen2017 G
MIR6085     1-0218-004chr15:
62890127-62890127
TAintergenicDe novo--Yuen2017 G
MIR6085     AU3702307chr15:
62689420-62689420
AGintergenicDe novo--Yuen2017 G
MIR6085     AU2293301chr15:
62739928-62739928
GAintergenicDe novo--Yuen2017 G
MIR6085     A18chr15:
62761930-62761930
CGintergenicDe novo--Wu2018 G
MIR6085     AU003406chr15:
62645690-62645690
GAintergenicDe novo--Yuen2017 G
MIR6085     1-0294-003chr15:
62648006-62648030
AGTTGTTGTTGTTGTTGTTGTTGTTAGTTGTTGTTGTTGTTGTTGTTintergenicDe novo--Yuen2017 G
MIR6085     1-0465-003achr15:
62803436-62803436
GAintergenicDe novo--Yuen2017 G
MIR6085     AU036203chr15:
62634653-62634653
GAupstreamDe novo--Yuen2017 G
MIR6085     2-1721-003chr15:
62882715-62882715
CTintergenicDe novo--Yuen2017 G
MIR6085     1-0007-003chr15:
62749141-62749141
GAintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More