or
or
Exact

Results for "LINC01108"

Variant Events: 62

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
LINC01108     2-0238-003chr6:
14516604-14516604
TAintergenicDe novo--Yuen2017 G
LINC01108     2-1355-004chr6:
14452176-14452176
CGintergenicDe novo--Yuen2017 G
LINC01108     1-0708-003chr6:
15048347-15048347
ATintergenicDe novo--Yuen2017 G
LINC01108     2-0102-004chr6:
14470511-14470511
ATintergenicDe novo--Yuen2017 G
LINC01108     7-0223-003chr6:
14500777-14500777
GAintergenicDe novo--Yuen2017 G
LINC01108     1-0377-003chr6:
14452206-14452206
GTintergenicDe novo--Yuen2017 G
LINC01108     2-1264-003chr6:
14983937-14983937
AGintergenicDe novo--Yuen2016 G
Yuen2017 G
LINC01108     AU075207chr6:
14567795-14567795
CTintergenicDe novo--Yuen2017 G
LINC01108     AU3695303chr6:
14949761-14949761
CTintergenicDe novo--Yuen2017 G
LINC01108     2-1362-004chr6:
14804378-14804378
AGintergenicDe novo--Yuen2017 G
LINC01108     2-1368-003chr6:
15027500-15027500
CAintergenicDe novo--Yuen2016 G
Yuen2017 G
LINC01108     AU3721301chr6:
14452805-14452805
TCintergenicDe novo--Yuen2017 G
LINC01108     AU3397302chr6:
15161408-15161408
GAintergenicDe novo--Yuen2017 G
LINC01108     AU3875301chr6:
15045447-15045447
TGintergenicDe novo--Yuen2017 G
LINC01108     AU4199303chr6:
15207647-15207647
CTintergenicDe novo--Yuen2017 G
LINC01108     AU4286302chr6:
14283207-14283207
GAncRNA_exonicDe novo--Yuen2017 G
LINC01108     2-1506-003chr6:
14661876-14661894
ACAGCAGCAGCAGCAGCAGACAGCAGCAGCAGCAGintergenicDe novo--Yuen2017 G
LINC01108     3-0438-000chr6:
15168640-15168640
GAintergenicDe novo--Yuen2016 G
LINC01108     2-1182-003chr6:
14925534-14925534
CTintergenicDe novo--Yuen2016 G
Yuen2017 G
LINC01108     1-0566-003chr6:
14381553-14381553
CGintergenicDe novo--Yuen2017 G
LINC01108     1-0494-003Achr6:
14453230-14453230
AGintergenicDe novo--Yuen2017 G
LINC01108     AU057404chr6:
14821962-14821962
GAintergenicDe novo--Yuen2017 G
LINC01108     5-0073-003chr6:
14487140-14487140
CTintergenicDe novo--Yuen2017 G
LINC01108     1-0261-003chr6:
14986826-14986826
TGintergenicDe novo--Yuen2017 G
LINC01108     1-0261-003chr6:
14456574-14456574
GTintergenicDe novo--Yuen2017 G
LINC01108     1-0534-006chr6:
14813500-14813501
TATintergenicDe novo--Yuen2017 G
LINC01108     2-1085-004chr6:
14803519-14803519
CCCCGAGTAGintergenicDe novo--Yuen2017 G
LINC01108     7-0141-003chr6:
15180507-15180507
GTintergenicDe novo--Yuen2017 G
LINC01108     A17chr6:
15076830-15076830
TCintergenicDe novo--Wu2018 G
LINC01108     1-0494-003chr6:
14453230-14453230
AGintergenicDe novo--Yuen2017 G
LINC01108     AU4067301chr6:
14360888-14360888
CTintergenicDe novo--Yuen2017 G
LINC01108     2-0307-004chr6:
14521220-14521220
AGintergenicDe novo--Yuen2017 G
LINC01108     5-0026-003chr6:
14524125-14524125
GAintergenicDe novo--Yuen2017 G
LINC01108     AU4234303chr6:
14641500-14641500
AGintergenicDe novo--Yuen2017 G
LINC01108     1-0041-003chr6:
14702507-14702511
GGAGAGintergenicDe novo--Yuen2016 G
LINC01108     1-0303-004chr6:
14753105-14753105
CAintergenicDe novo--Yuen2017 G
LINC01108     2-0198-003chr6:
14442362-14442362
GAintergenicDe novo--Yuen2017 G
LINC01108     1-0225-003chr6:
14618982-14618997
GTCTCTCTCTCTCTCTGTCTCTCTCTCTCTintergenicDe novo--Yuen2017 G
LINC01108     A2chr6:
14363053-14363053
AGintergenicDe novo--Wu2018 G
LINC01108     1-0175-004chr6:
14798679-14798679
CGintergenicDe novo--Yuen2017 G
LINC01108     2-0318-003chr6:
15058811-15058811
CAintergenicDe novo--Yuen2017 G
LINC01108     AU2381302chr6:
15131629-15131629
CTintergenicDe novo--Yuen2017 G
LINC01108     1-0191-003chr6:
15070022-15070022
CAintergenicDe novo--Yuen2017 G
LINC01108     1-0148-005chr6:
15197953-15197953
CTintergenicDe novo--Yuen2017 G
LINC01108     1-0534-003chr6:
14524125-14524125
GAintergenicDe novo--Yuen2017 G
LINC01108     11089.p1chr6:
14921510-14921510
CTintergenicDe novo--Turner2016 G
LINC01108     AU3874302chr6:
15209476-15209476
GAintergenicDe novo--Yuen2017 G
LINC01108     14590.p1chr6:
14486993-14486993
TCintergenicDe novo--Turner2016 G
LINC01108     5-0015-003chr6:
14317355-14317355
GGTGATTTAintergenicDe novo--Yuen2017 G
LINC01108     7-0148-003chr6:
14796335-14796335
TGintergenicDe novo--Yuen2017 G
LINC01108     AU3782303chr6:
14325796-14325796
AGintergenicDe novo--Yuen2017 G
LINC01108     11572.p1chr6:
14560887-14560887
AGintergenicDe novo--Turner2016 G
LINC01108     2-0296-004chr6:
14949821-14949821
GTintergenicDe novo--Yuen2017 G
LINC01108     1-0065-004chr6:
14474132-14474132
GCintergenicDe novo--Yuen2017 G
LINC01108     2-1283-003chr6:
15131870-15131870
TCintergenicDe novo--Yuen2017 G
LINC01108     2-0202-004chr6:
15087333-15087333
CTintergenicDe novo--Yuen2017 G
LINC01108     7-0068-003chr6:
14589561-14589561
AGintergenicDe novo--Yuen2017 G
LINC01108     1-0469-005chr6:
15109150-15109150
GTintergenicDe novo--Yuen2017 G
LINC01108     1-0485-003chr6:
14818227-14818227
TCintergenicDe novo--Yuen2017 G
LINC01108     1-0175-003chr6:
14798679-14798679
CGintergenicDe novo--Yuen2017 G
LINC01108     AU055004chr6:
14622363-14622363
CAintergenicDe novo--Yuen2017 G
LINC01108     1-1000-003chr6:
14290476-14290476
TAintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More