or
or
Exact

Results for "LOC101928622"

Variant Events: 110

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
LOC101928622    2-1369-003chr4:
34704016-34704016
CTintergenicDe novo--Yuen2016 G
Yuen2017 G
LOC101928622    AU011903chr4:
35235580-35235602
CATATATATATGTATATATATATCATATATATATATGTATATATATATintergenicDe novo--Yuen2017 G
LOC101928622    AU024607chr4:
34902211-34902211
TCintergenicDe novo--Yuen2017 G
LOC101928622    2-1729-003chr4:
35506569-35506569
AGintergenicDe novo--Yuen2017 G
LOC101928622    AU011903chr4:
35707416-35707416
AGintergenicDe novo--Yuen2017 G
LOC101928622    5-0055-003chr4:
35754650-35754650
GAintergenicDe novo--Yuen2017 G
LOC101928622    AU072004chr4:
34731978-34731978
GAintergenicDe novo--Yuen2017 G
LOC101928622    2-1690-003chr4:
33926304-33926304
TGncRNA_intronicDe novo--Yuen2017 G
LOC101928622    7-0023-003chr4:
35148234-35148234
GAintergenicDe novo--Yuen2017 G
LOC101928622    7-0023-003chr4:
35526606-35526606
CTintergenicDe novo--Yuen2017 G
LOC101928622    1-0511-003chr4:
34199561-34199575
TTCTCTCTCTCTCTCTTCTCTCTCTCTCintergenicDe novo--Yuen2017 G
LOC101928622    2-0198-005chr4:
35444504-35444504
CGintergenicDe novo--Yuen2017 G
LOC101928622    AU2108302chr4:
34095841-34095845
GATATGATintergenicDe novo--Yuen2017 G
LOC101928622    A3chr4:
34715082-34715082
CTintergenicDe novo--Wu2018 G
LOC101928622    AU3263301chr4:
35958456-35958456
TCintergenicDe novo--Yuen2017 G
LOC101928622    AU076508chr4:
34934791-34934791
TCintergenicDe novo--Yuen2017 G
LOC101928622    1-0563-004chr4:
35607286-35607286
CAintergenicDe novo--Yuen2017 G
LOC101928622    2-1356-003chr4:
35140786-35140786
GAintergenicDe novo--Yuen2016 G
Yuen2017 G
LOC101928622    1-0255-003 Complex Event; expand row to view variants  De novo--Yuen2016 G
Yuen2017 G
LOC101928622    1-0901-004chr4:
35647375-35647375
GAintergenicDe novo--Yuen2017 G
LOC101928622    2-0116-004chr4:
36050331-36050331
CTintergenicDe novo--Yuen2017 G
LOC101928622    1-0138-003chr4:
35315343-35315343
AGintergenicDe novo--Yuen2017 G
LOC101928622    AU3849302chr4:
35838765-35838765
GTintergenicDe novo--Yuen2017 G
LOC101928622    1-0043-003chr4:
34386130-34386130
CAintergenicDe novo--Yuen2017 G
LOC101928622    1-0338-005chr4:
34281776-34281776
AGintergenicDe novo--Yuen2017 G
LOC101928622    2-1475-003chr4:
34723111-34723111
GAintergenicDe novo--Yuen2017 G
LOC101928622    2-0102-003chr4:
35734220-35734220
CTintergenicDe novo--Yuen2017 G
LOC101928622    1-0496-003chr4:
34431265-34431265
ACintergenicDe novo--Yuen2016 G
Yuen2017 G
LOC101928622    1-0496-003chr4:
34674165-34674165
GAintergenicDe novo--Yuen2016 G
Yuen2017 G
LOC101928622    2-1562-004chr4:
35468136-35468136
CAintergenicDe novo--Yuen2017 G
LOC101928622    1-0560-003chr4:
34415257-34415269
CCAACAACAACAACCAACAACAAintergenicDe novo--Yuen2017 G
LOC101928622    2-1336-004chr4:
34652909-34652909
TCintergenicDe novo--Yuen2017 G
LOC101928622    AU2123301chr4:
34775241-34775241
GAintergenicDe novo--Yuen2017 G
LOC101928622    AU4231301chr4:
35406368-35406368
GAintergenicDe novo--Yuen2017 G
LOC101928622    AU3371302chr4:
34579229-34579229
CAintergenicDe novo--Yuen2017 G
LOC101928622    5-0041-003chr4:
35143859-35143859
TCintergenicDe novo--Yuen2017 G
LOC101928622    AU4237304chr4:
34560509-34560509
CAintergenicDe novo--Yuen2017 G
LOC101928622    2-1702-004chr4:
35938291-35938291
CTintergenicDe novo--Yuen2017 G
LOC101928622    AU2129303chr4:
34902191-34902191
AGintergenicDe novo--Yuen2017 G
LOC101928622    1-0466-003chr4:
35488213-35488213
TGintergenicDe novo--Yuen2017 G
LOC101928622    AU3768302chr4:
34304763-34304763
CGintergenicDe novo--Yuen2017 G
LOC101928622    AU3787303chr4:
35079468-35079468
GAintergenicDe novo--Yuen2017 G
LOC101928622    AU3703302chr4:
34106064-34106064
CTintergenicDe novo--Yuen2017 G
LOC101928622    AU3703302chr4:
34546554-34546554
TCintergenicDe novo--Yuen2017 G
LOC101928622    1-0401-003chr4:
35509093-35509093
TCintergenicDe novo--Yuen2017 G
LOC101928622    AU2109301chr4:
34838957-34838957
TCintergenicDe novo--Yuen2017 G
LOC101928622    13901.p1chr4:
34849168-34849169
GAGintergenicDe novo--Werling2018 G
LOC101928622    AU066818chr4:
35882517-35882517
TCintergenicDe novo--Yuen2017 G
LOC101928622    5-0055-004chr4:
35754650-35754650
GAintergenicDe novo--Yuen2017 G
LOC101928622    AU060403chr4:
35922874-35922874
AGintergenicDe novo--Yuen2017 G
LOC101928622    1-0120-003chr4:
34585844-34585844
TCintergenicDe novo--Yuen2017 G
LOC101928622    2-1357-003chr4:
34033669-34033669
CGncRNA_intronicDe novo--Yuen2017 G
LOC101928622    2-1646-003chr4:
35135213-35135213
CTintergenicDe novo--Yuen2017 G
LOC101928622    2-1646-003chr4:
35145908-35145908
GTintergenicDe novo--Yuen2017 G
LOC101928622    AU027506chr4:
34302943-34302943
TGintergenicDe novo--Yuen2017 G
LOC101928622    2-0102-004chr4:
36057370-36057370
GCintergenicDe novo--Yuen2017 G
LOC101928622    AU070703chr4:
34599132-34599132
CAintergenicDe novo--Yuen2017 G
LOC101928622    1-0559-004chr4:
34169938-34169938
AGintergenicDe novo--Yuen2017 G
LOC101928622    AU4027306chr4:
35217622-35217622
CTintergenicDe novo--Yuen2017 G
LOC101928622    AU4188302chr4:
35663944-35663944
CTintergenicDe novo--Yuen2017 G
LOC101928622    AU2156303chr4:
34925902-34925902
TGintergenicDe novo--Yuen2017 G
LOC101928622    1-0683-004chr4:
35852621-35852621
GAintergenicDe novo--Yuen2017 G
LOC101928622    AU065807chr4:
34713643-34713644
CTCintergenicDe novo--Yuen2017 G
LOC101928622    AU1933301chr4:
36046806-36046806
TCintergenicDe novo--Yuen2017 G
LOC101928622    2-1452-003chr4:
35409973-35409973
GAintergenicDe novo--Yuen2016 G
Yuen2017 G
LOC101928622    AU1894303chr4:
35138720-35138720
CTintergenicDe novo--Yuen2017 G
LOC101928622    2-0116-005chr4:
36011988-36011988
CTintergenicDe novo--Yuen2017 G
LOC101928622    1-0271-004chr4:
34523431-34523431
GAintergenicDe novo--Yuen2017 G
LOC101928622    AU3057301chr4:
34128981-34128981
AGintergenicDe novo--Yuen2017 G
LOC101928622    AU3862305chr4:
34733961-34733961
AGintergenicDe novo--Yuen2017 G
LOC101928622    1-0467-003chr4:
34975436-34975436
CAintergenicDe novo--Yuen2017 G
LOC101928622    1-0059-003chr4:
33947449-33947449
GAncRNA_intronicDe novo--Yuen2017 G
LOC101928622    2-0208-004chr4:
35986448-35986448
GAintergenicDe novo--Yuen2017 G
LOC101928622    2-1709-003chr4:
35385051-35385051
CTintergenicDe novo--Yuen2017 G
LOC101928622    1-0638-003chr4:
35432496-35432496
GAintergenicDe novo--Yuen2017 G
LOC101928622    AU3302302chr4:
34892426-34892426
GAintergenicDe novo--Yuen2017 G
LOC101928622    1-0367-003chr4:
36010272-36010272
CGintergenicDe novo--Yuen2017 G
LOC101928622    2-0303-004chr4:
35919107-35919107
CTintergenicDe novo--Yuen2017 G
LOC101928622    AU015903chr4:
35611821-35611836
AAGAGAGAGAGAGAGAAAGAGAGAGAGAGAintergenicDe novo--Yuen2017 G
LOC101928622    2-0198-004chr4:
35444504-35444504
CGintergenicDe novo--Yuen2017 G
LOC101928622    1-0546-003chr4:
34652993-34652993
CGintergenicDe novo--Yuen2017 G
LOC101928622    1-0518-003chr4:
35829403-35829403
TAintergenicDe novo--Yuen2016 G
Yuen2017 G
LOC101928622    5-0026-003chr4:
34808890-34808890
TAintergenicDe novo--Yuen2017 G
LOC101928622    2-1508-004chr4:
35119242-35119242
GAintergenicDe novo--Yuen2017 G
LOC101928622    AU4263304chr4:
34939573-34939573
CAintergenicDe novo--Yuen2017 G
LOC101928622    1-0757-003chr4:
34668468-34668468
GAintergenicDe novo--Yuen2017 G
LOC101928622    1-0973-003chr4:
35640563-35640563
GTintergenicDe novo--Yuen2017 G
LOC101928622    A17chr4:
35246454-35246454
CTintergenicDe novo--Wu2018 G
LOC101928622    7-0251-003chr4:
35615784-35615784
TCintergenicDe novo--Yuen2017 G
LOC101928622    1-0032-003chr4:
35151492-35151492
GAintergenicDe novo--Yuen2017 G
LOC101928622    12449.p1chr4:
35257369-35257369
CGintergenicDe novo--Turner2016 G
LOC101928622    AU3190305chr4:
36059686-36059686
AGintergenicDe novo--Yuen2017 G
LOC101928622    13298.p1chr4:
35389215-35389215
ACintergenicDe novo--Turner2016 G
LOC101928622    7-0012-003chr4:
35258091-35258091
GAintergenicDe novo--Yuen2017 G
LOC101928622    1-0354-003chr4:
35607286-35607286
CAintergenicDe novo--Yuen2017 G
LOC101928622    1-0699-003chr4:
35093396-35093399
GACAGAintergenicDe novo--Yuen2017 G
LOC101928622    2-1605-004chr4:
34702747-34702747
GAintergenicDe novo--Yuen2017 G
LOC101928622    2-1252-003chr4:
36003528-36003528
GAintergenicDe novo--Yuen2017 G
LOC101928622    2-1605-004chr4:
35607286-35607286
CAintergenicDe novo--Yuen2017 G
LOC101928622    AU002406chr4:
34462295-34462298
TAAATAintergenicDe novo--Yuen2017 G
LOC101928622    AU3765302chr4:
34023340-34023341
CTCncRNA_intronicDe novo--Yuen2017 G
LOC101928622    1-0450-003chr4:
35439060-35439060
TCintergenicDe novo--Yuen2017 G
LOC101928622    1-0338-003chr4:
35607286-35607286
CAintergenicDe novo--Yuen2017 G
LOC101928622    2-0090-003chr4:
34087106-34087106
TCintergenicDe novo--Yuen2017 G
LOC101928622    1-0092-004chr4:
35650621-35650621
TGintergenicDe novo--Yuen2017 G
LOC101928622    2-0149-003chr4:
35629496-35629496
TCintergenicDe novo--Yuen2017 G
LOC101928622    5-0114-003chr4:
35912646-35912646
TCintergenicDe novo--Yuen2017 G
LOC101928622    AU4347301chr4:
34151553-34151553
ATintergenicDe novo--Yuen2017 G
LOC101928622    1-0339-004chr4:
35137341-35137341
AGintergenicDe novo--Yuen2017 G
LOC101928622    2-1176-003chr4:
35536713-35536713
CTintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More