or
or
Exact

Results for "CDH12"

Variant Events: 97

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
CDH12     1-0259-003chr5:
23263411-23263411
TCintergenicDe novo--Yuen2017 G
CDH12     2-1166-003chr5:
23155269-23155269
GCintergenicDe novo--Yuen2017 G
CDH12     7-0095-004chr5:
22117692-22117692
CCTATTintronicDe novo--Yuen2017 G
CDH12     AU1795302chr5:
23359311-23359311
CGintergenicDe novo--Yuen2017 G
CDH12     AU072905chr5:
22527690-22527690
GAintronicDe novo--Yuen2017 G
CDH12     2-1180-003chr5:
23416673-23416673
GTintergenicDe novo--Yuen2016 G
Yuen2017 G
CDH12     AU1955302chr5:
22695955-22695955
CTintronicDe novo--Yuen2017 G
CDH12     1-0484-003chr5:
23397743-23397743
GAintergenicDe novo--Yuen2017 G
CDH12     AU049304chr5:
22759831-22759831
AGintronicDe novo--Yuen2017 G
CDH12     AU4452302chr5:
23472269-23472269
ACintergenicDe novo--Yuen2017 G
CDH12     AU3263301chr5:
22348421-22348421
GAintronicDe novo--Yuen2017 G
CDH12     7-0254-003chr5:
22416165-22416170
AGGTCTAintronicDe novo--Yuen2017 G
CDH12     AU1909304chr5:
23440812-23440812
CTintergenicDe novo--Yuen2017 G
CDH12     2-1501-003chr5:
22574069-22574069
CTintronicDe novo--Yuen2017 G
CDH12     AU2140306chr5:
22854442-22854442
CTupstreamDe novo--Yuen2017 G
CDH12     2-1345-003chr5:
22129340-22129340
CTintronicDe novo--Yuen2017 G
CDH12     AU4410302chr5:
21946874-21946874
TAintronicDe novo--Yuen2017 G
CDH12     AU058105chr5:
22416344-22416344
CTintronicDe novo--Yuen2017 G
CDH12     2-1381-003chr5:
22219553-22219553
TAintronicDe novo--Yuen2017 G
CDH12     AU3727303chr5:
22557204-22557204
AGintronicDe novo--Yuen2017 G
CDH12     2-1454-003chr5:
22750783-22750783
GAintronicDe novo--Yuen2017 G
CDH12     1-0874-003chr5:
22561863-22561863
GCintronicDe novo--Yuen2017 G
CDH12     1-0372-003chr5:
21940702-21940702
TCintronicDe novo--Yuen2017 G
CDH12     AU4392301chr5:
23456829-23456829
CTintergenicDe novo--Yuen2017 G
CDH12     1-0715-003chr5:
22988373-22988373
AGintergenicDe novo--Yuen2017 G
CDH12     1-0305-004chr5:
22267275-22267275
GAintronicDe novo--Yuen2017 G
CDH12     AU3913302chr5:
23438383-23438383
GAintergenicDe novo--Yuen2017 G
CDH12     1-0453-003chr5:
21904310-21904310
CAintronicDe novo--Yuen2017 G
CDH12     08C72543chr5:
21760757-21760757
GAexonicDe novostopgainNM_001317227
NM_001317228
NM_004061
c.C1543T
c.C1423T
c.C1543T
p.R515X
p.R475X
p.R515X
42.02.473E-5Satterstrom2020 E
CDH12     AU071703chr5:
22305521-22305521
TAintronicDe novo--Yuen2017 G
CDH12     AU072005chr5:
22154882-22154882
GAintronicDe novo--Yuen2017 G
CDH12     1-0274-004chr5:
22267040-22267040
CTintronicDe novo--Yuen2017 G
CDH12     1-0022-004chr5:
23390323-23390323
GTintergenicDe novo--Yuen2017 G
CDH12     1-0458-005chr5:
22773177-22773177
GAintronicDe novo--Yuen2017 G
CDH12     2-1318-004chr5:
21860952-21860952
GGACAGTTCCCAAintronicDe novo--Yuen2017 G
CDH12     2-0244-003chr5:
22648826-22648826
TAintronicDe novo--Yuen2017 G
CDH12     5-0055-004chr5:
22527107-22527107
CAintronicDe novo--Yuen2017 G
CDH12     1-0007-003chr5:
23388002-23388002
GAintergenicDe novo--Yuen2017 G
CDH12     7-0168-003chr5:
22330167-22330167
CAintronicDe novo--Yuen2017 G
CDH12     AU050704chr5:
22714728-22714728
ACintronicDe novo--Yuen2017 G
CDH12     AU060403chr5:
22977024-22977026
AATAintergenicDe novo--Yuen2017 G
CDH12     AU047904chr5:
23023513-23023513
CTintergenicDe novo--Yuen2017 G
CDH12     AU051504chr5:
21941944-21941944
CTintronicDe novo--Yuen2017 G
CDH12     2-1213-003chr5:
22113110-22113119
AATCATCATCAATCATCintronicDe novo--Yuen2017 G
CDH12     2-1264-003chr5:
22863577-22863577
TCintergenicDe novo--Yuen2016 G
Yuen2017 G
CDH12     2-0022-003chr5:
22969212-22969212
GTintergenicDe novo--Yuen2017 G
CDH12     1-0068-003chr5:
23504605-23504605
GTintergenicDe novo--Yuen2017 G
CDH12     AU3849303chr5:
23344386-23344386
TCintergenicDe novo--Yuen2017 G
CDH12     1-0068-003chr5:
21775833-21775833
TGintronicDe novo--Yuen2017 G
CDH12     7-0161-003chr5:
21970306-21970306
TCintronicDe novo--Yuen2017 G
CDH12     5-0133-003chr5:
22639022-22639022
TTGATGGCGGGCGCintronicDe novo--Yuen2017 G
CDH12     1-0169-003chr5:
21837528-21837528
GAintronicDe novo--Yuen2017 G
CDH12     2-1369-003chr5:
21999848-21999848
AGintronicDe novo--Yuen2017 G
CDH12     AU3051302chr5:
21768151-21768151
TCintronicDe novo--Yuen2017 G
CDH12     1-0336-004chr5:
22967628-22967628
AGintergenicDe novo--Yuen2017 G
CDH12     AU3839302chr5:
22284504-22284504
TCintronicDe novo--Yuen2017 G
CDH12     1-0006-003chr5:
22683829-22683829
AGintronicDe novo--Yuen2017 G
CDH12     2-0320-003chr5:
22127097-22127097
TCintronicDe novo--Yuen2017 G
CDH12     7-0179-003chr5:
22671364-22671377
CTGTGTGTGTGTGTCTGTGTGTGTGTintronicDe novo--Yuen2017 G
CDH12     AU4246304chr5:
23371786-23371786
AGintergenicDe novo--Yuen2017 G
CDH12     2-1366-003chr5:
22514144-22514144
TCintronicDe novo--Yuen2017 G
CDH12     1-0339-003chr5:
22068776-22068776
CCAintronicDe novo--Yuen2017 G
CDH12     2-1506-003chr5:
22087623-22087625
ACCACCCintronicDe novo--Yuen2017 G
CDH12     12680.p1chr5:
23045439-23045439
CTintergenicDe novo--Turner2016 G
CDH12     12529.p1 Complex Event; expand row to view variants  De novo--Turner2016 G
Turner2016 G
CDH12     2-1366-003chr5:
22549345-22549345
GAintronicDe novo--Yuen2017 G
CDH12     AU3846303chr5:
22493359-22493359
TCintronicDe novo--Yuen2017 G
CDH12     2-0127-004chr5:
23281095-23281095
CGintergenicDe novo--Yuen2017 G
CDH12     1-0022-003chr5:
23390323-23390323
GTintergenicDe novo--Yuen2016 G
CDH12     AU4032307chr5:
22492637-22492637
GAintronicDe novo--Yuen2017 G
CDH12     1-0206-005chr5:
21874513-21874513
TGintronicDe novo--Yuen2017 G
CDH12     AU030104chr5:
22244623-22244648
AAAAAAAAAAAAAAAAAAAAGAAGAAAAAintronicDe novo--Yuen2017 G
CDH12     1-0585-003chr5:
22043538-22043538
ATintronicDe novo--Yuen2017 G
CDH12     2-0142-003chr5:
23341424-23341424
GAintergenicDe novo--Yuen2017 G
CDH12     AU005213chr5:
21758518-21758518
CAintronicDe novo--Yuen2017 G
CDH12     AU4153301chr5:
21871608-21871608
GAintronicDe novo--Yuen2017 G
CDH12     13143.p1chr5:
22897322-22897322
TCintergenicDe novo--Wilfert2021 G
CDH12     11519.p1chr5:
22261921-22261921
CAintronicDe novo--Wilfert2021 G
CDH12     A17chr5:
23448687-23448687
CTintergenicDe novo--Wu2018 G
CDH12     AU034903chr5:
22382777-22382777
CAintronicDe novo--Yuen2017 G
CDH12     AU4237301chr5:
22530444-22530444
TCintronicDe novo--Yuen2017 G
CDH12     A7chr5:
22292345-22292345
CGintronicDe novo--Wu2018 G
CDH12     2-1330-003chr5:
23485710-23485710
AGintergenicDe novo--Yuen2016 G
Yuen2017 G
CDH12     AU3057302chr5:
23365793-23365793
TAintergenicDe novo--Yuen2017 G
CDH12     AU071203chr5:
22080539-22080539
GAintronicDe novo--Yuen2017 G
CDH12     1-0197-004chr5:
22441853-22441853
GAintronicDe novo--Yuen2017 G
CDH12     AU3399302chr5:
23193505-23193505
GAintergenicDe novo--Yuen2017 G
CDH12     AU3765302chr5:
22699794-22699794
TCintronicDe novo--Yuen2017 G
CDH12     1-0158-012chr5:
21908116-21908116
ACintronicDe novo--Yuen2017 G
CDH12     AU2162302chr5:
22770315-22770315
TCintronicDe novo--Yuen2017 G
CDH12     AU4250301chr5:
22089198-22089198
TCintronicDe novo--Yuen2017 G
CDH12     1-0253-004chr5:
22229483-22229485
CTACintronicDe novo--Yuen2017 G
CDH12     AU063005chr5:
21929751-21929751
CTintronicDe novo--Yuen2017 G
CDH12     AU076704chr5:
22952473-22952473
AGintergenicDe novo--Yuen2017 G
CDH12     AU4423303chr5:
22774741-22774741
CAintronicDe novo--Yuen2017 G
CDH12     AU3885305chr5:
21961725-21961725
TCintronicDe novo--Yuen2017 G
CDH12     1-0274-003chr5:
22267040-22267040
CTintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More