or
or
Exact

Results for "MIR4436A"

Variant Events: 192

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
MIR4436A     AU4186302chr2:
90479084-90479084
CTintergenicDe novo--Yuen2017 G
MIR4436A     08C77216chr2:
89442255-89442255
GAintergenicDe novo-1.0E-4Satterstrom2020 E
MIR4436A     AU4079301chr2:
90483206-90483206
GTintergenicDe novo--Yuen2017 G
MIR4436A     1-0511-003chr2:
90472834-90472834
CTintergenicDe novo--Yuen2017 G
MIR4436A     NDAR_INVEB022VLQ_wes1chr2:
89160048-89160048
ATintergenicDe novo-4.176E-5Kosmicki2017 E
Satterstrom2020 E
MIR4436A     NDAR_INVEB022VLQ_wes1chr2:
89160395-89160395
TAintergenicDe novo-1.0E-4Kosmicki2017 E
Satterstrom2020 E
MIR4436A     NDAR_INVEB022VLQ_wes1 Complex Event; expand row to view variants  De novo-3.0E-4Kosmicki2017 E
Kosmicki2017 E
Satterstrom2020 E
Satterstrom2020 E
MIR4436A     AU034904chr2:
90156074-90156074
ACintergenicDe novo--Yuen2017 G
MIR4436A     AC02-1124-01chr2:
89161363-89161363
GAintergenicDe novo-8.473E-6Kosmicki2017 E
Satterstrom2020 E
MIR4436A     AU1355301chr2:
90469396-90469396
ATintergenicDe novo--Yuen2017 G
MIR4436A     200675379@1082034622chr2:
89185522-89185522
GAintergenicDe novo-2.0E-4Satterstrom2020 E
MIR4436A     AC02-1124-01chr2:
89185322-89185322
TGintergenicDe novo--Kosmicki2017 E
Satterstrom2020 E
MIR4436A     2-1337-003chr2:
90209472-90209472
GAintergenicDe novo--Yuen2016 G
Yuen2017 G
MIR4436A     11064.p1chr2:
89417320-89417320
ATintergenicDe novo--Iossifov2014 E
Kosmicki2017 E
MIR4436A     11055.p1chr2:
90260191-90260191
TCintergenicDe novo-0.1701Iossifov2014 E
Kosmicki2017 E
MIR4436A     08C73837chr2:
89185173-89185173
AGintergenicDe novo-5.903E-5Satterstrom2020 E
MIR4436A     2-1358-003chr2:
89383083-89383083
CGintergenicDe novo--Yuen2017 G
MIR4436A     08C74541chr2:
89416972-89416972
TGintergenicDe novo--Satterstrom2020 E
MIR4436A     AU3777302chr2:
89185379-89185379
ACintergenicDe novo--Satterstrom2020 E
MIR4436A     11619.p1chr2:
89247321-89247321
TGintergenicDe novo--Satterstrom2020 E
MIR4436A     2-1581-003chr2:
90121817-90121817
TAintergenicDe novo--Yuen2017 G
MIR4436A     AU026604chr2:
89312763-89312763
TAintergenicDe novo--Yuen2017 G
MIR4436A     1-0304-003chr2:
89972046-89972046
GAintergenicDe novo--Yuen2017 G
MIR4436A     1-0976-003chr2:
89840975-89840975
CTintergenicDe novo--Yuen2017 G
MIR4436A     2-1195-003chr2:
90187838-90187838
TCintergenicDe novo--Yuen2017 G
MIR4436A     2-1195-003chr2:
90023321-90023321
GAintergenicDe novo--Yuen2017 G
MIR4436A     AU054304chr2:
89246559-89246559
TAintergenicDe novo--Yuen2017 G
MIR4436A     2-1632-003chr2:
90413194-90413194
GTintergenicDe novo--Yuen2017 G
MIR4436A     1-0441-003chr2:
90032102-90032102
CTintergenicDe novo--Yuen2016 G
Yuen2017 G
MIR4436A     5-0110-003chr2:
90229884-90229884
ATintergenicDe novo--Yuen2017 G
MIR4436A     09C99845chr2:
89247150-89247150
AGintergenicDe novo-9.202E-5Satterstrom2020 E
MIR4436A     AU1153302chr2:
89417073-89417073
TAintergenicDe novo-9.214E-6Satterstrom2020 E
MIR4436A     08C74483chr2:
89246823-89246823
TAintergenicDe novo--Satterstrom2020 E
MIR4436A     AU3632301chr2:
90258431-90258431
CTintergenicDe novo--Yuen2017 G
MIR4436A     2-1397-003chr2:
89174723-89174723
CAintergenicDe novo--Yuen2017 G
MIR4436A     AU3125301chr2:
89436271-89436271
AGintergenicDe novo--Yuen2017 G
MIR4436A     08C78540chr2:
89161096-89161097
TCTintergenicDe novo--Satterstrom2020 E
MIR4436A     AU031404chr2:
89836553-89836553
CGintergenicDe novo--Yuen2017 G
MIR4436A     2-1730-003chr2:
89831415-89831415
CTintergenicDe novo--Yuen2017 G
MIR4436A     AU3787303chr2:
90478474-90478474
CTintergenicDe novo--Yuen2017 G
MIR4436A     AU3263302chr2:
89987798-89987798
CTintergenicDe novo--Yuen2017 G
MIR4436A     14058.p1chr2:
89890648-89890648
TAintergenicMosaic Mat.-5.0E-4Dou2017 E
MIR4436A     AU021204chr2:
89863913-89863954
TTCCATTCCATTCCATTACATACGAGTCCATTCCATTCCATTTTCCATTCCATTCCATTintergenicDe novo--Yuen2017 G
MIR4436A     09C86398chr2:
89442346-89442346
CGintergenicDe novo-8.3E-6Satterstrom2020 E
MIR4436A     AU050704chr2:
89479911-89479911
GAintergenicDe novo--Yuen2017 G
MIR4436A     05HI4259Achr2:
89442330-89442330
CTintergenicDe novo-1.659E-5Satterstrom2020 E
MIR4436A     1-0651-003chr2:
90413712-90413712
GAintergenicDe novo--Yuen2017 G
MIR4436A     AU3605304chr2:
90373631-90373631
GAintergenicDe novo--Yuen2017 G
MIR4436A     08C73276chr2:
89185416-89185416
ACintergenicDe novo-8.455E-6Satterstrom2020 E
MIR4436A     1-0651-003chr2:
89390841-89390841
GCintergenicDe novo--Yuen2017 G
MIR4436A     08C76519chr2:
89185548-89185548
ATintergenicDe novo-8.429E-6Satterstrom2020 E
MIR4436A     08C78339chr2:
89185659-89185659
AGintergenicDe novo-8.716E-6Satterstrom2020 E
MIR4436A     98HI0405Achr2:
89185172-89185172
TCintergenicDe novo-1.686E-5Satterstrom2020 E
MIR4436A     1-0512-003chr2:
90481517-90481517
CGintergenicDe novo--Yuen2017 G
MIR4436A     08C74782chr2:
89185400-89185400
GCintergenicDe novo-1.698E-5Satterstrom2020 E
MIR4436A     AU3398301chr2:
90487059-90487059
CTintergenicDe novo--Yuen2017 G
MIR4436A     11572.p1chr2:
89185335-89185335
ACintergenicDe novo-1.789E-5Krumm2015 E
Turner2016 G
MIR4436A     5-0148-003chr2:
89525353-89525353
GTintergenicDe novo--Yuen2017 G
MIR4436A     11572.p1chr2:
89416950-89416950
ACintergenicDe novo--Krumm2015 E
MIR4436A     12306.p1chr2:
89345797-89345797
AGintergenicDe novo--Krumm2015 E
MIR4436A     Lim2017:35873chr2:
89185561-89185561
TAintergenicDe novo--Lim2017 E
MIR4436A     08C74982chr2:
89326839-89326839
CAintergenicDe novo-1.664E-5Satterstrom2020 E
MIR4436A     AU050403chr2:
89411300-89411300
TAintergenicDe novo--Yuen2017 G
MIR4436A     5-0074-003chr2:
90148540-90148540
TGintergenicDe novo--Yuen2017 G
MIR4436A     04C36352chr2:
89246945-89246945
ATintergenicDe novo-1.667E-5Satterstrom2020 E
MIR4436A     08C76577chr2:
89247063-89247063
GTintergenicDe novo-1.668E-5Satterstrom2020 E
MIR4436A     06C59211chr2:
89185392-89185392
ACintergenicDe novo-1.702E-5Satterstrom2020 E
MIR4436A     1-0572-003chr2:
89612471-89612471
CTintergenicDe novo--Yuen2017 G
MIR4436A     5-0054-003chr2:
89351578-89351578
CAintergenicDe novo--Yuen2017 G
MIR4436A     09C86398chr2:
89160406-89160406
TAintergenicDe novo--Satterstrom2020 E
MIR4436A     AU3839302chr2:
89851577-89851577
CTintergenicDe novo--Yuen2017 G
MIR4436A     3-0111-000chr2:
89164355-89164355
TAintergenicDe novo--Yuen2016 G
MIR4436A     3-0111-000chr2:
89163403-89163403
GAintergenicDe novo--Yuen2016 G
MIR4436A     10C109067chr2:
89326787-89326787
TGintergenicDe novo-2.498E-5Satterstrom2020 E
MIR4436A     AU3634301chr2:
89153386-89153386
TCintergenicDe novo--Yuen2017 G
MIR4436A     AU3905301chr2:
90480744-90480795
GCTTGGCTGGCTGTGTGGCTTGGCTGTCTTGGCTGGCTGGGTGGCTTGGCTGGCTTGGCTGGCTGGGTGGCTTGGCTGintergenicDe novo--Yuen2017 G
MIR4436A     1-0995-003chr2:
89541090-89541090
ACintergenicDe novo--Yuen2017 G
MIR4436A     AU1941302chr2:
89185585-89185585
TCintergenicDe novo--Satterstrom2020 E
MIR4436A     07C67708chr2:
89246984-89246984
TCintergenicDe novo-3.333E-5Satterstrom2020 E
MIR4436A     3-0111-000chr2:
89165176-89165176
GCintergenicDe novo--Yuen2016 G
MIR4436A     08C76004chr2:
89185615-89185615
CTintergenicDe novo-2.538E-5Satterstrom2020 E
MIR4436A     AU066403chr2:
89453810-89453810
CAintergenicDe novo--Yuen2017 G
MIR4436A     3-0111-000chr2:
89165174-89165174
TCintergenicDe novo--Yuen2016 G
MIR4436A     05C49422chr2:
89160050-89160050
TGintergenicDe novo-1.67E-5Satterstrom2020 E
MIR4436A     AU063004chr2:
90469318-90469318
GAintergenicDe novo--Yuen2017 G
MIR4436A     AU4239301chr2:
89311591-89311591
AGintergenicDe novo--Yuen2017 G
MIR4436A     200675290@1082034269chr2:
89161063-89161063
CGintergenicDe novo-8.362E-6Satterstrom2020 E
MIR4436A     08C74853chr2:
89161098-89161098
CAintergenicDe novo-8.476E-6Satterstrom2020 E
MIR4436A     AU4239301chr2:
89278974-89278974
GAintergenicDe novo--Yuen2017 G
MIR4436A     AU4239301chr2:
89286923-89286923
AGintergenicDe novo--Yuen2017 G
MIR4436A     11572.p1chr2:
89185529-89185529
TCintergenicDe novo-5.051E-5Satterstrom2020 E
MIR4436A     08C76577chr2:
89160795-89160795
CTintergenicDe novo-9.325E-6Satterstrom2020 E
MIR4436A     2-1237-003chr2:
89264233-89264233
TCintergenicDe novo--Yuen2017 G
MIR4436A     09C79810chr2:
89160734-89160734
TGintergenicDe novo-1.791E-5Satterstrom2020 E
MIR4436A     04C36352chr2:
89161033-89161033
TAintergenicDe novo-1.67E-5Satterstrom2020 E
MIR4436A     08C72821chr2:
89160046-89160046
ATintergenicDe novo-2.506E-5Satterstrom2020 E
MIR4436A     08C74660chr2:
89160484-89160484
GAintergenicDe novo-3.346E-5Satterstrom2020 E
MIR4436A     7-0149-003chr2:
89856535-89856535
CTintergenicDe novo--Yuen2017 G
MIR4436A     08C72819chr2:
89161052-89161052
TCintergenicDe novo-2.503E-5Satterstrom2020 E
MIR4436A     01C05699chr2:
89442262-89442262
CGintergenicDe novo-9.961E-5Satterstrom2020 E
MIR4436A     02C09879chr2:
89160054-89160054
GCintergenicDe novo-3.337E-5Satterstrom2020 E
MIR4436A     200675387@1082034407chr2:
90044295-90044295
ACintergenicDe novo--Satterstrom2020 E
MIR4436A     08C72662chr2:
89160782-89160782
GAintergenicDe novo-4.633E-5Satterstrom2020 E
MIR4436A     98HI0379Achr2:
89161007-89161007
AGintergenicDe novo-3.344E-5Satterstrom2020 E
MIR4436A     2-1741-003chr2:
90179720-90179720
GAintergenicDe novo--Yuen2017 G
MIR4436A     08C74430chr2:
89185474-89185474
GCintergenicDe novo-1.0E-4Satterstrom2020 E
MIR4436A     200675339@1082034658chr2:
89161060-89161060
TGintergenicDe novo-3.348E-5Satterstrom2020 E
MIR4436A     10C108736chr2:
89161018-89161018
AGintergenicDe novo-3.343E-5Satterstrom2020 E
MIR4436A     10C108725chr2:
89160717-89160717
AGintergenicDe novo-3.639E-5Satterstrom2020 E
MIR4436A     08C76562chr2:
89160382-89160382
ATintergenicDe novo-4.984E-5Satterstrom2020 E
MIR4436A     10C102191chr2:
89160457-89160457
TGintergenicDe novo-4.193E-5Satterstrom2020 E
MIR4436A     AU3786301chr2:
89179711-89179711
TCintergenicDe novo--Yuen2017 G
MIR4436A     AU4463303chr2:
89294720-89294720
GCintergenicDe novo--Yuen2017 G
MIR4436A     08C75066chr2:
89161036-89161036
CGintergenicDe novo-4.176E-5Satterstrom2020 E
MIR4436A     12044.p1chr2:
89160476-89160476
CTintergenicMosaic--Dou2017 E
MIR4436A     10C116616chr2:
89161060-89161060
TCintergenicDe novo-5.022E-5Satterstrom2020 E
MIR4436A     1-0606-003chr2:
89333408-89333408
CTintergenicDe novo--Yuen2017 G
MIR4436A     05C44735chr2:
89160792-89160792
TAintergenicDe novo-4.651E-5Satterstrom2020 E
MIR4436A     08C75663chr2:
89442247-89442247
TAintergenicDe novo-2.0E-4Satterstrom2020 E
MIR4436A     08C74000chr2:
89160399-89160399
TGintergenicDe novo-5.812E-5Satterstrom2020 E
MIR4436A     1-0868-003chr2:
89850850-89850859
ATTCCGTTCCATTCCGTTCCGTTCCintergenicDe novo--Yuen2017 G
MIR4436A     08C74281chr2:
89160379-89160379
AGintergenicDe novo-5.813E-5Satterstrom2020 E
MIR4436A     08C76609chr2:
89160108-89160108
GAintergenicDe novo-6.645E-5Satterstrom2020 E
MIR4436A     200675300@1082034284chr2:
89161004-89161004
ACintergenicDe novo-5.017E-5Satterstrom2020 E
MIR4436A     2-1427-003chr2:
90220147-90220147
CTintergenicDe novo--Yuen2017 G
MIR4436A     AU024606chr2:
89438013-89438013
CTintergenicDe novo--Yuen2017 G
MIR4436A     AU050603chr2:
89412943-89412943
AGintergenicDe novo--Yuen2017 G
MIR4436A     AU0638302chr2:
89162263-89162263
CTintergenicDe novo--Yuen2017 G
MIR4436A     08C72016chr2:
89185485-89185485
CTintergenicDe novo-2.0E-4Satterstrom2020 E
MIR4436A     08C72686chr2:
90025173-90025173
AGintergenicDe novo--Satterstrom2020 E
MIR4436A     08C73410chr2:
89160409-89160409
ATintergenicDe novo-5.81E-5Satterstrom2020 E
MIR4436A     07C69123chr2:
89161016-89161016
TCintergenicDe novo-5.852E-5Satterstrom2020 E
MIR4436A     08C72686chr2:
89160369-89160369
ATintergenicDe novo-7.477E-5Satterstrom2020 E
MIR4436A     09C85767chr2:
89442260-89442260
CTintergenicDe novo-2.0E-4Satterstrom2020 E
MIR4436A     07C69352chr2:
89161018-89161018
ACintergenicDe novo-5.85E-5Satterstrom2020 E
MIR4436A     AU054303chr2:
90415976-90415976
AGintergenicDe novo--Yuen2017 G
MIR4436A     07C66440chr2:
89160461-89160461
CGintergenicDe novo-6.712E-5Satterstrom2020 E
MIR4436A     1-0304-003chr2:
89144608-89144608
GTintergenicDe novo--Yuen2016 G
Yuen2017 G
MIR4436A     08C72918chr2:
89161356-89161356
AGintergenicDe novo-6.782E-5Satterstrom2020 E
MIR4436A     AU2381302chr2:
90162239-90162239
CTintergenicDe novo--Yuen2017 G
MIR4436A     AU0638302chr2:
90478528-90478528
CGintergenicDe novo--Yuen2017 G
MIR4436A     08C75009chr2:
89160484-89160484
GCintergenicDe novo-7.528E-5Satterstrom2020 E
MIR4436A     00HI1371Achr2:
89161067-89161067
AGintergenicDe novo-9.203E-5Satterstrom2020 E
MIR4436A     AU3506303chr2:
89850850-89850859
ATTCCGTTCCATTCCGTTCCGTTCCintergenicDe novo--Yuen2017 G
MIR4436A     AU3858302chr2:
89241675-89241676
GAGintergenicDe novo--Yuen2017 G
MIR4436A     05C48774chr2:
90229108-90229108
TAintergenicDe novo--Satterstrom2020 E
MIR4436A     AU2072302chr2:
89363446-89363446
ATintergenicDe novo--Yuen2017 G
MIR4436A     AU3861301chr2:
89244839-89244839
CTintergenicDe novo--Yuen2017 G
MIR4436A     10C105645chr2:
89160999-89160999
TAintergenicDe novo-1.0E-4Satterstrom2020 E
MIR4436A     2-1279-003chr2:
90033661-90033661
AGintergenicDe novo--Yuen2017 G
MIR4436A     AU3881301chr2:
90126867-90126871
CTTTTCTTTTTintergenicDe novo--Yuen2017 G
MIR4436A     08C77419chr2:
89160125-89160125
TGintergenicDe novo-1.0E-4Satterstrom2020 E
MIR4436A     200675261@1082034753chr2:
89160997-89160997
AGintergenicDe novo-1.0E-4Satterstrom2020 E
MIR4436A     2-0090-003chr2:
90478389-90478390
TCTCCintergenicDe novo--Yuen2017 G
MIR4436A     AU066104chr2:
89585062-89585062
GAintergenicDe novo--Yuen2017 G
MIR4436A     08C76385chr2:
89160356-89160356
TGintergenicDe novo-1.0E-4Satterstrom2020 E
MIR4436A     10C109067chr2:
89160161-89160161
TCintergenicDe novo-1.0E-4Satterstrom2020 E
MIR4436A     1-1004-003chr2:
89843934-89843934
GAintergenicDe novo--Yuen2017 G
MIR4436A     10C106627chr2:
89161031-89161031
ACintergenicDe novo-1.0E-4Satterstrom2020 E
MIR4436A     08C75214chr2:
89160165-89160165
CGintergenicDe novo-1.0E-4Satterstrom2020 E
MIR4436A     AU2793302chr2:
89609033-89609033
TGintergenicDe novo--Yuen2017 G
MIR4436A     08C76562chr2:
89246994-89246994
TAintergenicDe novo--Satterstrom2020 E
MIR4436A     08C73163chr2:
89160074-89160074
ACintergenicDe novo-2.0E-4Satterstrom2020 E
MIR4436A     07C71059chr2:
89442513-89442513
ACintergenicDe novo-8.316E-6Satterstrom2020 E
MIR4436A     AU1772302chr2:
89161072-89161072
TGintergenicDe novo-1.0E-4Satterstrom2020 E
MIR4436A     08C75363chr2:
89160070-89160070
AGintergenicDe novo-2.0E-4Satterstrom2020 E
MIR4436A     08C75317chr2:
89442552-89442552
ATintergenicDe novo--Satterstrom2020 E
MIR4436A     200675360@1082034754chr2:
89161049-89161049
GAintergenicDe novo-2.0E-4Satterstrom2020 E
MIR4436A     08C72692chr2:
89197114-89197114
GCintergenicDe novo--Satterstrom2020 E
MIR4436A     05C44989chr2:
89292250-89292250
GAintergenicDe novo-4.178E-5Satterstrom2020 E
MIR4436A     200675758@1082034134chr2:
89160362-89160362
AGintergenicDe novo-2.0E-4Satterstrom2020 E
MIR4436A     AU1635302chr2:
89524122-89524122
TCintergenicDe novo--Yuen2017 G
MIR4436A     08C76609chr2:
89185536-89185536
CGintergenicDe novo--Satterstrom2020 E
MIR4436A     2-1164-003chr2:
90130792-90130792
GAintergenicDe novo--Yuen2017 G
MIR4436A     08C74637chr2:
89278206-89278206
GCintergenicDe novo--Satterstrom2020 E
MIR4436A     09C89897chr2:
89292259-89292259
AGintergenicDe novo-8.353E-6Satterstrom2020 E
MIR4436A     A18chr2:
89504736-89504736
TCintergenicDe novo--Wu2018 G
MIR4436A     2-1116-003chr2:
89552159-89552159
GCintergenicDe novo--Yuen2016 G
Yuen2017 G
MIR4436A     10C105645chr2:
89185431-89185431
ACintergenicDe novo--Satterstrom2020 E
MIR4436A     08C75698chr2:
89160375-89160375
AGintergenicDe novo-2.0E-4Satterstrom2020 E
MIR4436A     1-0708-003chr2:
90266511-90266511
CGintergenicDe novo--Yuen2017 G
MIR4436A     AU3777302chr2:
90403645-90403645
GAintergenicDe novo--Yuen2017 G
MIR4436A     08C76606chr2:
89160356-89160356
TCintergenicDe novo-3.0E-4Satterstrom2020 E
MIR4436A     200675339@1082034658chr2:
89196838-89196838
TAintergenicDe novo--Satterstrom2020 E
MIR4436A     08C72794chr2:
89160061-89160061
AGintergenicDe novo-3.0E-4Satterstrom2020 E
MIR4436A     2-1373-003chr2:
90454510-90454513
CAAACAintergenicDe novo--Yuen2017 G
MIR4436A     AU2129301chr2:
90478010-90478010
TCintergenicDe novo--Yuen2017 G
MIR4436A     04C29159chr2:
89160483-89160483
AGintergenicDe novo-4.0E-4Satterstrom2020 E
MIR4436A     1-0871-003chr2:
89453261-89453261
GAintergenicDe novo--Yuen2017 G
MIR4436A     AU4028302chr2:
89366558-89366558
AGintergenicDe novo--Yuen2017 G
MIR4436A     HI0085chr2:
89161432-89161432
CCTTintergenicDe novo--Satterstrom2020 E
MIR4436A     2-1411-003chr2:
89281809-89281809
GTintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More