or
or
Exact

Results for "LOC100506474"

Variant Events: 54

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
LOC100506474    1-0481-003chr2:
13329311-13329311
GGAintergenicDe novo--Yuen2017 G
LOC100506474    2-1502-003chr2:
14353795-14353795
GAintergenicDe novo--Yuen2017 G
LOC100506474    AU3728301chr2:
13777764-13777764
TCintergenicDe novo--Yuen2017 G
LOC100506474    2-1719-003chr2:
13872836-13872836
AGintergenicDe novo--Yuen2017 G
LOC100506474    2-0144-003chr2:
14250823-14250823
CTintergenicDe novo--Yuen2017 G
LOC100506474    AU3891304chr2:
14276597-14276597
CTintergenicDe novo--Yuen2017 G
LOC100506474    1-0493-003 Complex Event; expand row to view variants  De novo--Yuen2016 G
Yuen2017 G
LOC100506474    5-0117-003chr2:
13875730-13875730
GCintergenicDe novo--Yuen2017 G
LOC100506474    AU0452303chr2:
13969198-13969198
ACintergenicDe novo--Yuen2017 G
LOC100506474    AU076808chr2:
13138168-13138168
GAncRNA_intronicDe novo--Yuen2017 G
LOC100506474    1-0763-003chr2:
13456927-13456927
CTintergenicDe novo--Yuen2017 G
LOC100506474    AU012804chr2:
14112543-14112543
GAintergenicDe novo--Yuen2017 G
LOC100506474    AU009903chr2:
13380570-13380570
ATintergenicDe novo--Yuen2017 G
LOC100506474    2-1085-004chr2:
13985221-13985221
TCintergenicDe novo--Yuen2017 G
LOC100506474    AU3811305chr2:
13276159-13276159
GAintergenicDe novo--Yuen2017 G
LOC100506474    AU4012302chr2:
14186505-14186505
CTintergenicDe novo--Yuen2017 G
LOC100506474    A14chr2:
14227836-14227836
TCintergenicDe novo--Wu2018 G
LOC100506474    1-0483-003chr2:
13219240-13219240
TGintergenicDe novo--Yuen2016 G
Yuen2017 G
LOC100506474    AU4153301chr2:
14177393-14177406
TATATATGATATATTATATATintergenicDe novo--Yuen2017 G
LOC100506474    AU4070301chr2:
14353471-14353471
CAintergenicDe novo--Yuen2017 G
LOC100506474    2-0272-004chr2:
13734439-13734439
CTintergenicDe novo--Yuen2017 G
LOC100506474    AU3632301chr2:
13351844-13351844
CTintergenicDe novo--Yuen2017 G
LOC100506474    1-0555-003chr2:
14179764-14179764
CTintergenicDe novo--Yuen2017 G
LOC100506474    2-1429-003chr2:
14298147-14298147
CGintergenicDe novo--Yuen2017 G
LOC100506474    AU1725306chr2:
13623228-13623228
CTintergenicDe novo--Yuen2017 G
LOC100506474    AU1725306chr2:
14207592-14207594
TAATAintergenicDe novo--Yuen2017 G
LOC100506474    AU4356302chr2:
13546254-13546254
AGintergenicDe novo--Yuen2017 G
LOC100506474    AU4164301chr2:
13306877-13306877
GTintergenicDe novo--Yuen2017 G
LOC100506474    2-1617-003chr2:
13969290-13969290
GTintergenicDe novo--Yuen2017 G
LOC100506474    1-0473-003chr2:
14227322-14227322
GTintergenicDe novo--Yuen2017 G
LOC100506474    2-1451-004chr2:
13360933-13360933
ACintergenicDe novo--Yuen2017 G
LOC100506474    1-0404-003chr2:
13506771-13506775
GAAAAGAAAintergenicDe novo--Yuen2017 G
LOC100506474    1-0209-003chr2:
13853860-13853860
TCintergenicDe novo--Yuen2017 G
LOC100506474    2-1186-003chr2:
14018940-14018940
CTintergenicDe novo--Yuen2016 G
Yuen2017 G
LOC100506474    AU4069302chr2:
13558354-13558356
CTGCintergenicDe novo--Yuen2017 G
LOC100506474    AU066818chr2:
13457179-13457179
AGintergenicDe novo--Yuen2017 G
LOC100506474    1-0006-004chr2:
14083355-14083355
GAintergenicDe novo--Yuen2017 G
LOC100506474    AU3811301chr2:
13307329-13307329
CTintergenicDe novo--Yuen2017 G
LOC100506474    1-0531-003chr2:
13754176-13754176
CTintergenicDe novo--Yuen2017 G
LOC100506474    1-0755-003chr2:
13860634-13860634
AGintergenicDe novo--Yuen2017 G
LOC100506474    5-0148-003 Complex Event; expand row to view variants  De novo--Yuen2017 G
Yuen2017 G
LOC100506474    7-0242-003chr2:
13533533-13533533
AGintergenicDe novo--Yuen2017 G
LOC100506474    2-0214-003chr2:
13897244-13897244
TTAAACintergenicDe novo--Yuen2017 G
LOC100506474    2-1154-003chr2:
14345692-14345692
CTintergenicDe novo--Yuen2016 G
Yuen2017 G
LOC100506474    1-0414-005chr2:
13500026-13500026
TCintergenicDe novo--Yuen2017 G
LOC100506474    1-0169-004chr2:
14305108-14305108
AGintergenicDe novo--Yuen2017 G
LOC100506474    AU4314302chr2:
13331934-13331934
GCintergenicDe novo--Yuen2017 G
LOC100506474    AU072004chr2:
13330700-13330700
GAintergenicDe novo--Yuen2017 G
LOC100506474    5-0014-004chr2:
13112091-13112091
TCncRNA_intronicDe novo--Yuen2017 G
LOC100506474    2-1335-003chr2:
14141100-14141100
AGintergenicDe novo--Yuen2017 G
LOC100506474    7-0123-003chr2:
13630561-13630561
CTintergenicDe novo--Yuen2017 G
LOC100506474    7-0254-004chr2:
14203980-14203983
AGGGAGGintergenicDe novo--Yuen2017 G
LOC100506474    2-1364-003chr2:
13411351-13411351
GAintergenicDe novo--Yuen2017 G
LOC100506474    AU3371303chr2:
13484691-13484691
AGintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More