or
or
Exact

Results for "ARRDC3-AS1"

Variant Events: 116

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
ARRDC3-AS1     2-1428-003chr5:
92019030-92019030
TCintergenicDe novo--Yuen2016 G
Yuen2017 G
ARRDC3-AS1     1-0265-004chr5:
91709519-91709519
TCintergenicDe novo--Yuen2017 G
ARRDC3-AS1     AU2035301chr5:
91293449-91293449
TGintergenicDe novo--Yuen2017 G
ARRDC3-AS1     2-1729-003chr5:
92202569-92202569
CTintergenicDe novo--Yuen2017 G
ARRDC3-AS1     AU3724302chr5:
91362723-91362723
GAintergenicDe novo--Yuen2017 G
ARRDC3-AS1     2-0704-003chr5:
91111973-91111978
CTTTTTCTTTTintergenicDe novo--Yuen2017 G
ARRDC3-AS1     DEASD_0444_001chr5:
90678623-90678627
AACTTAncRNA_intronicDe novo--Kosmicki2017 E
Satterstrom2020 E
ARRDC3-AS1     2-1339-003chr5:
91292786-91292786
TCintergenicDe novo--Yuen2017 G
ARRDC3-AS1     2-1296-003chr5:
91727167-91727167
CAintergenicDe novo--Yuen2017 G
ARRDC3-AS1     7-0167-003chr5:
92175246-92175253
CAAAAAAACAAAAAAAAintergenicDe novo--Yuen2017 G
ARRDC3-AS1     AU049304chr5:
90929339-90929339
TCintergenicDe novo--Yuen2017 G
ARRDC3-AS1     1-0336-003chr5:
91429599-91429599
AGintergenicDe novo--Yuen2017 G
ARRDC3-AS1     1-0627-004chr5:
91954842-91954842
AGintergenicDe novo--Yuen2017 G
ARRDC3-AS1     2-0215-003chr5:
91429599-91429599
AGintergenicDe novo--Yuen2017 G
ARRDC3-AS1     2-0296-003chr5:
91053937-91053937
TGintergenicDe novo--Yuen2017 G
ARRDC3-AS1     AU3891302chr5:
92676107-92676107
CTintergenicDe novo--Yuen2017 G
ARRDC3-AS1     3-0432-000chr5:
92182145-92182145
CTintergenicDe novo--Yuen2016 G
Yuen2017 G
ARRDC3-AS1     AU1988301chr5:
91727783-91727783
ACintergenicDe novo--Yuen2017 G
ARRDC3-AS1     A3chr5:
92512114-92512114
TCintergenicDe novo--Wu2018 G
ARRDC3-AS1     5-0025-003chr5:
92238516-92238516
GCintergenicDe novo--Yuen2017 G
ARRDC3-AS1     5-0095-003chr5:
91909815-91909815
AGintergenicDe novo--Yuen2017 G
ARRDC3-AS1     AU038204chr5:
91748221-91748221
ATintergenicDe novo--Yuen2017 G
ARRDC3-AS1     2-1261-004chr5:
91429599-91429599
AGintergenicDe novo--Yuen2017 G
ARRDC3-AS1     1-0834-003chr5:
92275215-92275215
CTintergenicDe novo--Yuen2017 G
ARRDC3-AS1     1-0408-003chr5:
90945604-90945604
GAintergenicDe novo--Yuen2016 G
Yuen2017 G
ARRDC3-AS1     AU024104chr5:
90888719-90888719
CAintergenicDe novo--Yuen2017 G
ARRDC3-AS1     AU4410302chr5:
92098827-92098835
GTATTATTAGTATTAintergenicDe novo--Yuen2017 G
ARRDC3-AS1     1-0455-004chr5:
92442943-92442944
CACintergenicDe novo--Yuen2017 G
ARRDC3-AS1     2-1350-004chr5:
91585975-91585975
TCintergenicDe novo--Yuen2017 G
ARRDC3-AS1     1-0896-003chr5:
91769380-91769380
TCintergenicDe novo--Yuen2017 G
ARRDC3-AS1     AU024608chr5:
91231955-91231955
TCintergenicDe novo--Yuen2017 G
ARRDC3-AS1     AU4372309chr5:
91514182-91514182
AGintergenicDe novo--Yuen2017 G
ARRDC3-AS1     AU4243302chr5:
92293515-92293515
CTintergenicDe novo--Yuen2017 G
ARRDC3-AS1     AU3649304chr5:
92420106-92420106
CTintergenicDe novo--Yuen2017 G
ARRDC3-AS1     1-0043-003chr5:
92582733-92582733
TCintergenicDe novo--Yuen2017 G
ARRDC3-AS1     AU3918301chr5:
91829710-91829710
CTintergenicDe novo--Yuen2017 G
ARRDC3-AS1     AU4231301chr5:
92521850-92521850
CAintergenicDe novo--Yuen2017 G
ARRDC3-AS1     AU4356302chr5:
92318015-92318015
GAintergenicDe novo--Yuen2017 G
ARRDC3-AS1     2-1738-003chr5:
91868245-91868245
TCintergenicDe novo--Yuen2017 G
ARRDC3-AS1     2-1143-003chr5:
91985133-91985133
TGintergenicDe novo--Yuen2017 G
ARRDC3-AS1     2-1186-003chr5:
91313648-91313648
ACintergenicDe novo--Yuen2016 G
Yuen2017 G
ARRDC3-AS1     AU056804chr5:
92334299-92334299
TCintergenicDe novo--Yuen2017 G
ARRDC3-AS1     1-0756-005chr5:
92055918-92055918
CGintergenicDe novo--Yuen2017 G
ARRDC3-AS1     2-1245-003chr5:
91509923-91509927
CATATCATintergenicDe novo--Yuen2017 G
ARRDC3-AS1     2-1245-003chr5:
90855029-90855029
GTintergenicDe novo--Yuen2017 G
ARRDC3-AS1     AU030804chr5:
91930164-91930164
TCintergenicDe novo--Yuen2017 G
ARRDC3-AS1     1-0526-003chr5:
91464629-91464633
TAAAGTintergenicDe novo--Yuen2017 G
ARRDC3-AS1     7-0127-003chr5:
91979022-91979022
GAintergenicDe novo--Yuen2017 G
ARRDC3-AS1     7-0148-003chr5:
91392308-91392308
GAintergenicDe novo--Yuen2017 G
ARRDC3-AS1     A16chr5:
91078845-91078845
TTTintergenicDe novo--Wu2018 G
ARRDC3-AS1     AU4079302chr5:
90755478-90755478
TCintergenicDe novo--Yuen2017 G
ARRDC3-AS1     2-1477-003chr5:
91841853-91841853
GAintergenicDe novo--Yuen2017 G
ARRDC3-AS1     2-0307-003chr5:
91429645-91429645
AGintergenicDe novo--Yuen2017 G
ARRDC3-AS1     1-0512-003chr5:
92490813-92490828
ATCTCTCTCTCTCTCTATCTCTCTCTCTCTintergenicDe novo--Yuen2017 G
ARRDC3-AS1     AU4462302chr5:
90867386-90867386
TCintergenicDe novo--Yuen2017 G
ARRDC3-AS1     2-1389-003chr5:
91886646-91886659
GTATATATATATATGTATATATATATintergenicDe novo--Yuen2017 G
ARRDC3-AS1     AU003403chr5:
92076648-92076648
TGintergenicDe novo--Yuen2017 G
ARRDC3-AS1     AU024105chr5:
91900630-91900630
CAintergenicDe novo--Yuen2017 G
ARRDC3-AS1     2-1277-004chr5:
91009804-91009804
GAintergenicDe novo--Yuen2017 G
ARRDC3-AS1     1-0835-003chr5:
91445218-91445218
ACintergenicDe novo--Yuen2017 G
ARRDC3-AS1     A16chr5:
92565354-92565354
TCintergenicDe novo--Wu2018 G
ARRDC3-AS1     A16chr5:
92504019-92504019
TCintergenicDe novo--Wu2018 G
ARRDC3-AS1     AU3859301chr5:
92338026-92338026
TCintergenicDe novo--Yuen2017 G
ARRDC3-AS1     5-0099-003chr5:
91753352-91753352
CTintergenicDe novo--Yuen2017 G
ARRDC3-AS1     74-0355chr5:
91378595-91378595
TCintergenicDe novo--Michaelson2012 G
ARRDC3-AS1     2-1290-003chr5:
92297686-92297686
ATintergenicDe novo--Yuen2017 G
ARRDC3-AS1     AU025704chr5:
91921105-91921105
AGintergenicDe novo--Yuen2017 G
ARRDC3-AS1     1-0190-003chr5:
92508295-92508295
CTintergenicDe novo--Yuen2017 G
ARRDC3-AS1     1-0190-003chr5:
91009529-91009529
TAintergenicDe novo--Yuen2017 G
ARRDC3-AS1     1-0169-003chr5:
91567166-91567166
CTintergenicDe novo--Yuen2017 G
ARRDC3-AS1     1-0489-003chr5:
92441229-92441229
ACintergenicDe novo--Yuen2017 G
ARRDC3-AS1     2-1561-003chr5:
91569726-91569728
CTTCTintergenicDe novo--Yuen2017 G
ARRDC3-AS1     2-1306-004chr5:
91429599-91429599
AGintergenicDe novo--Yuen2017 G
ARRDC3-AS1     2-1371-003chr5:
92521548-92521548
CTintergenicDe novo--Yuen2016 G
Yuen2017 G
ARRDC3-AS1     2-1366-003chr5:
92459884-92459884
CAintergenicDe novo--Yuen2017 G
ARRDC3-AS1     2-1366-003chr5:
91939105-91939108
TTTATintergenicDe novo--Yuen2017 G
ARRDC3-AS1     2-0132-004chr5:
92007504-92007505
CACintergenicDe novo--Yuen2017 G
ARRDC3-AS1     1-0010-005chr5:
91429372-91429372
CTintergenicDe novo--Yuen2017 G
ARRDC3-AS1     2-1709-003chr5:
91156029-91156030
TATAAintergenicDe novo--Yuen2017 G
ARRDC3-AS1     7-0035-003chr5:
92335024-92335024
TCintergenicDe novo--Yuen2017 G
ARRDC3-AS1     2-1146-003chr5:
92036410-92036410
GAintergenicDe novo--Yuen2017 G
ARRDC3-AS1     7-0100-003chr5:
91188121-91188121
CTintergenicDe novo--Yuen2017 G
ARRDC3-AS1     1-0347-003chr5:
91635926-91635926
CAintergenicDe novo--Yuen2017 G
ARRDC3-AS1     2-1335-004chr5:
91615632-91615632
AGintergenicDe novo--Yuen2017 G
ARRDC3-AS1     AU4012302chr5:
90841701-90841701
GAintergenicDe novo--Yuen2017 G
ARRDC3-AS1     1-0203-004chr5:
90694448-90694448
AGncRNA_intronicDe novo--Yuen2017 G
ARRDC3-AS1     2-0297-003chr5:
92344621-92344621
AGintergenicDe novo--Yuen2017 G
ARRDC3-AS1     14329.p1chr5:
91038624-91038624
TGintergenicDe novo--Wilfert2021 G
ARRDC3-AS1     AU046707chr5:
91140871-91140871
GCintergenicDe novo--Yuen2017 G
ARRDC3-AS1     AU4468301chr5:
92025695-92025695
AGintergenicDe novo--Yuen2017 G
ARRDC3-AS1     AU4093301chr5:
92624354-92624357
TACATAintergenicDe novo--Yuen2017 G
ARRDC3-AS1     2-1328-003chr5:
91702752-91702752
AGintergenicDe novo--Yuen2016 G
Yuen2017 G
ARRDC3-AS1     2-1328-003chr5:
91703563-91703563
GTintergenicDe novo--Yuen2016 G
Yuen2017 G
ARRDC3-AS1     1-0627-003chr5:
92600959-92600959
CAintergenicDe novo--Yuen2017 G
ARRDC3-AS1     2-1169-004chr5:
92133247-92133247
AGintergenicDe novo--Yuen2017 G
ARRDC3-AS1     1-0201-005chr5:
92548413-92548413
TGintergenicDe novo--Yuen2017 G
ARRDC3-AS1     1-0201-005chr5:
91429599-91429599
AGintergenicDe novo--Yuen2017 G
ARRDC3-AS1     1-0446-003chr5:
91699548-91699548
GGAAintergenicDe novo--Yuen2017 G
ARRDC3-AS1     2-1529-003chr5:
92341316-92341319
CAGACAintergenicDe novo--Yuen2017 G
ARRDC3-AS1     1-0473-003chr5:
90694450-90694450
CTncRNA_intronicDe novo--Yuen2017 G
ARRDC3-AS1     AU002406chr5:
92697926-92697926
TCintergenicDe novo--Yuen2017 G
ARRDC3-AS1     1-0191-003chr5:
92360792-92360792
CGintergenicDe novo--Yuen2017 G
ARRDC3-AS1     AU3506303chr5:
91972525-91972525
ATintergenicDe novo--Yuen2017 G
ARRDC3-AS1     AU002406chr5:
91001358-91001358
TCintergenicDe novo--Yuen2017 G
ARRDC3-AS1     13515.p1chr5:
90896552-90896552
CTintergenicDe novo--Turner2016 G
ARRDC3-AS1     1-1004-003chr5:
91033611-91033611
CTintergenicDe novo--Yuen2017 G
ARRDC3-AS1     12175.p1chr5:
92372978-92372978
TAintergenicDe novo--Turner2016 G
ARRDC3-AS1     1-0841-003chr5:
91742234-91742234
TCintergenicDe novo--Yuen2017 G
ARRDC3-AS1     7-0080-003chr5:
92610741-92610741
TCintergenicDe novo--Yuen2017 G
ARRDC3-AS1     1-0520-003chr5:
92490554-92490554
AGintergenicDe novo--Yuen2016 G
Yuen2017 G
ARRDC3-AS1     1-0593-003chr5:
92109548-92109575
CAGAGAGAGAGAGAGAAAGAGAGAGAGACAGAGAGAGAGAGAAAGAGAGAGAGAintergenicDe novo--Yuen2017 G
ARRDC3-AS1     AU3847302chr5:
91257935-91257935
CTintergenicDe novo--Yuen2017 G
ARRDC3-AS1     AU2793302chr5:
92021472-92021472
AGintergenicDe novo--Yuen2017 G
ARRDC3-AS1     1-0169-004chr5:
92662768-92662768
GAintergenicDe novo--Yuen2017 G
ARRDC3-AS1     2-0297-004chr5:
92001943-92001943
AGintergenicDe novo--Yuen2017 G
ARRDC3-AS1     2-1305-003chr5:
91988590-91988590
CTintergenicDe novo--Yuen2016 G
Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More