or
or
Exact

Results for "TSHZ3"

Variant Events: 21

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
TSHZ3     1-0566-003chr19:
32063407-32063407
CTintergenicDe novo--Yuen2017 G
TSHZ3     2-1112-003chr19:
31922021-31922021
GAintergenicDe novo--Yuen2016 G
Yuen2017 G
TSHZ3     2-0704-003chr19:
31856802-31856802
GAintergenicDe novo--Yuen2016 G
TSHZ3     AU4242302chr19:
31993794-31993794
CGintergenicDe novo--Yuen2017 G
TSHZ3     08C72692chr19:
31840055-31840055
GAintronicDe novo--Satterstrom2020 E
TSHZ3     1-0512-003chr19:
31768038-31768038
GAexonicDe novosynonymous SNVNM_020856c.C2661Tp.P887P-1.0E-4Yuen2017 G
TSHZ3     AU2108302chr19:
31998420-31998420
TCintergenicDe novo--Yuen2017 G
TSHZ3     2-0098-003chr19:
31873811-31873825
CTGTGTGTGTGTGTGCTGTGTGTGTGTGintergenicDe novo--Yuen2017 G
TSHZ3     AU2950301chr19:
31993100-31993100
CAintergenicDe novo--Yuen2017 G
TSHZ3     1-0186-005chr19:
31894277-31894277
TCintergenicDe novo--Yuen2017 G
TSHZ3     1-0158-012chr19:
32050776-32050776
CTintergenicDe novo--Yuen2017 G
TSHZ3     1-0144-005chr19:
31970862-31970862
CAintergenicDe novo--Yuen2017 G
TSHZ3     AU3787303chr19:
31932351-31932351
TCintergenicDe novo--Yuen2017 G
TSHZ3     7-0167-003chr19:
31963155-31963155
GAintergenicDe novo--Yuen2017 G
TSHZ3     1-0971-003chr19:
31927406-31927406
GAintergenicDe novo--Yuen2017 G
TSHZ3     AU4033303chr19:
31874461-31874461
GAintergenicDe novo--Yuen2017 G
TSHZ3     1-0120-003chr19:
31916465-31916465
GAintergenicDe novo--Yuen2017 G
TSHZ3     2-1277-004chr19:
31807235-31807235
CCTTGTATGCAintronicDe novo--Yuen2017 G
TSHZ3     Ishay2021:36chr19:
31769293-31769293
TCexonicInheritednonsynonymous SNVNM_020856c.A1406Gp.E469G18.150.0081Ishay2021 E
TSHZ3     2-1267-003chr19:
31888316-31888316
CAintergenicDe novo--Yuen2017 G
TSHZ3     AU3808304chr19:
32029640-32029640
GAintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More