Variant Results

or

or

Results for "DISP2"

Variant Events: 8

Gene Gene symbol on which the variant is located	ID Subject Identifier from the original study	Location Genomic location of the reference allele	REF Reference allele	ALT Alternate allele	Context Variant functional categories	Variant validation performed by an orthogonal method and reported	Inheritance Reported inheritance status	Effects Variant effect on transcript per Annovar	Transcript Transcript used for the cDNA/Protein mutation	cDNA cDNA variant notation	Protein Protein variant notation	CADD-Phred v1.0 CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores	ExAC v0.3 ExAC population frequency (version 0.3)	Sources Source(s) where variants from this event are reported
DISP2	2-1109-004	chr15: 40662439-40662463	GTGCTGCCCAATAGCCAGCCAGACC	G	exonic		De novo	nonframeshift deletion	NM_033510	c.4127_4150del	p.1376_1384del	-	2.673E-5	Trost2022 G Zhou2022 GE
DISP2	mAGRE2533	chr15: 40660010-40660010	G	A	exonic		Paternal	stopgain	NM_033510	c.G1697A	p.W566X	38.0	-	Cirnigliaro2023 G
DISP2	mAGRE2532	chr15: 40660010-40660010	G	A	exonic		Paternal	stopgain	NM_033510	c.G1697A	p.W566X	38.0	-	Cirnigliaro2023 G
DISP2	mAGRE4537	chr15: 40659633-40659633	G	GC	exonic		Paternal	frameshift insertion	NM_033510	c.1321dupC	p.L440fs	-	-	Cirnigliaro2023 G
DISP2	5-0071-003	chr15: 40672714-40672714	T	C	intergenic		De novo					-	-	Yuen2017 G
DISP2	iHART2533	chr15: 40660010-40660010	G	A	exonic		Paternal	stopgain	NM_033510	c.G1697A	p.W566X	38.0	-	Ruzzo2019 G
DISP2	iHART2532	chr15: 40660010-40660010	G	A	exonic		Paternal	stopgain	NM_033510	c.G1697A	p.W566X	38.0	-	Ruzzo2019 G
DISP2	1-0121-003	chr15: 40656374-40656374	C	T	intronic		De novo					-	-	Trost2022 G Yuen2017 G

Source Variant Information

, -

Source:

Paper alias:

No records found.

Paper Information

Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count	The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notes	View
	More