or
or
Exact

Results for "RBM19"

Variant Events: 41

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
RBM19     AU4465303chr12:
114540105-114540105
TCintergenicDe novo--Yuen2017 G
RBM19     5-0050-004chr12:
114626458-114626458
TCintergenicDe novo--Yuen2017 G
RBM19     1-0489-003chr12:
114524636-114524636
TAintergenicDe novo--Yuen2016 G
Yuen2017 G
RBM19     3-0458-000Achr12:
114379456-114379484
CTCCATCCATCCATCCATCCATCCATCCACTCCATCCATCCATCCATCCATCCAintronicDe novo--Yuen2017 G
RBM19     AU3782302chr12:
114519085-114519085
GAintergenicDe novo--Yuen2017 G
RBM19     AU3846303chr12:
114405464-114405464
CTintergenicDe novo--Yuen2017 G
RBM19     1-0224-004chr12:
114415469-114415469
AGintergenicDe novo--Yuen2017 G
RBM19     AU4069302chr12:
114501628-114501628
CTintergenicDe novo--Yuen2017 G
RBM19     1-0336-003chr12:
114739572-114739572
CAintergenicDe novo--Yuen2017 G
RBM19     AU2485305chr12:
114329327-114329327
GCintronicDe novo--Yuen2017 G
RBM19     12498.p1chr12:
114566829-114566829
TAintergenicDe novo--Turner2016 G
RBM19     2-1105-003chr12:
114362501-114362501
CTsplicingDe novosplicing13.94-Yuen2016 G
Yuen2017 G
RBM19     AU2863302chr12:
114376297-114376297
TCintronicDe novo--Yuen2017 G
RBM19     1-0912-003chr12:
114603569-114603569
CTintergenicDe novo--Yuen2017 G
RBM19     A8chr12:
114705420-114705420
GCintergenicDe novo--Wu2018 G
RBM19     2-0295-003chr12:
114612331-114612331
CAintergenicDe novo--Yuen2017 G
RBM19     AU4433301chr12:
114269776-114269777
ACACCintronicDe novo--Yuen2017 G
RBM19     7-0044-003chr12:
114307411-114307411
GAintronicDe novo--Yuen2017 G
RBM19     AU3451301chr12:
114554123-114554123
GTintergenicDe novo--Yuen2017 G
RBM19     AU048206chr12:
114677795-114677795
CTintergenicDe novo--Yuen2017 G
RBM19     2-1277-004chr12:
114551165-114551165
GAintergenicDe novo--Yuen2017 G
RBM19     3-0431-000chr12:
114626293-114626293
AGintergenicDe novo--Yuen2017 G
RBM19     AU4376301chr12:
114402405-114402405
TGintronicDe novo--Yuen2017 G
RBM19     2-0007-003chr12:
114548070-114548070
AGintergenicDe novo--Yuen2017 G
RBM19     AU4376301chr12:
114437091-114437091
GAintergenicDe novo--Yuen2017 G
RBM19     AU0780301chr12:
114483703-114483703
CGintergenicDe novo--Yuen2017 G
RBM19     2-1451-003chr12:
114786986-114786986
GAintergenicDe novo--Yuen2017 G
RBM19     AU4496301chr12:
114297295-114297295
GAintronicDe novo--Yuen2017 G
RBM19     AU101Achr12:
114397232-114397232
GAintronicDe novo-2.536E-5Kosmicki2017 E
Satterstrom2020 E
RBM19     2-1451-003chr12:
114783342-114783342
GAintergenicDe novo--Yuen2017 G
RBM19     AU4093304chr12:
114649651-114649662
GGAGGACATGAGGGAGintergenicDe novo--Yuen2017 G
RBM19     AU4496301chr12:
114557508-114557508
GAintergenicDe novo--Yuen2017 G
RBM19     09C96031chr12:
114398011-114398011
ACintronicDe novo-3.0E-4Kosmicki2017 E
RBM19     2-1452-003chr12:
114352870-114352870
CTexonicDe novononsynonymous SNVNM_001146698
NM_001146699
NM_016196
c.G2462A
c.G2462A
c.G2462A
p.R821Q
p.R821Q
p.R821Q
15.492.0E-4Yuen2016 G
Yuen2017 G
RBM19     2-1451-004chr12:
114657799-114657799
CTintergenicDe novo--Yuen2017 G
RBM19     AU2525302chr12:
114608656-114608656
CTintergenicDe novo--Yuen2017 G
RBM19     2-1275-003chr12:
114726478-114726478
GAintergenicDe novo--Yuen2017 G
RBM19     5-0025-003chr12:
114788494-114788494
CTintergenicDe novo--Yuen2017 G
RBM19     AU4473301chr12:
114497397-114497397
CTintergenicDe novo--Yuen2017 G
RBM19     1-0699-003chr12:
114412461-114412461
CTintergenicDe novo--Yuen2017 G
RBM19     AU4150301chr12:
114558088-114558088
TCintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More