or
or
Exact

Results for "RUNX1"

Variant Events: 39

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
RUNX1     AU0638302chr21:
36431604-36431604
TAintergenicDe novo--Yuen2017 G
RUNX1     AU1725306chr21:
36337383-36337383
TCintronicDe novo--Yuen2017 G
RUNX1     1-0352-005chr21:
36308149-36308149
TCintronicDe novo--Yuen2017 G
RUNX1     1-0898-003chr21:
36684797-36684797
TCintergenicDe novo--Yuen2017 G
RUNX1     5-0041-003chr21:
36263876-36263876
TCintronicDe novo--Yuen2017 G
RUNX1     AU024004chr21:
36553042-36553052
AATTATTATTAAATTAintergenicDe novo--Yuen2017 G
RUNX1     PN400125chr21:
36262032-36262032
CAintronicInherited10.51-Leblond2019 E
RUNX1     AU3889305chr21:
36383051-36383051
CTintronicDe novo--Yuen2017 G
RUNX1     AU4007302chr21:
36512859-36512859
CTintergenicDe novo--Yuen2017 G
RUNX1     1-0059-003chr21:
36658412-36658412
TCintergenicDe novo--Yuen2017 G
RUNX1     1-0373-003chr21:
36350427-36350427
GTintronicDe novo--Yuen2017 G
RUNX1     1-0054-003chr21:
36539327-36539327
TGintergenicDe novo--Yuen2017 G
RUNX1     AU031204chr21:
36189680-36189682
TAATAintronicDe novo--Yuen2017 G
RUNX1     7-0103-003chr21:
36394700-36394700
CTintronicDe novo--Yuen2017 G
RUNX1     1-0303-004chr21:
36529808-36529808
TAintergenicDe novo--Yuen2017 G
RUNX1     2-1627-003chr21:
36562419-36562423
AGATTAintergenicDe novo--Yuen2017 G
RUNX1     1-0352-003chr21:
36308149-36308149
TCintronicDe novo--Yuen2016 G
RUNX1     2-1363-003chr21:
36366135-36366149
GACACACACACACACGACACACACACACintronicDe novo--Yuen2017 G
RUNX1     1-0606-003chr21:
36215330-36215330
GAintronicDe novo--Yuen2017 G
RUNX1     2-1153-003chr21:
36497327-36497327
CAintergenicDe novo--Yuen2016 G
Yuen2017 G
RUNX1     14015.p1chr21:
36492503-36492503
CTintergenicDe novo--Turner2016 G
RUNX1     2-1549-003chr21:
36704070-36704070
CTintergenicDe novo--Yuen2017 G
RUNX1     2-0225-004chr21:
36612161-36612161
GCintergenicDe novo--Yuen2017 G
RUNX1     2-1466-003chr21:
36520425-36520425
CTintergenicDe novo--Yuen2016 G
Yuen2017 G
RUNX1     AU4159302chr21:
36338898-36338898
AGintronicDe novo--Yuen2017 G
RUNX1     2-0225-004chr21:
36552200-36552200
AGintergenicDe novo--Yuen2017 G
RUNX1     AU2975302chr21:
36382924-36382924
AGintronicDe novo--Yuen2017 G
RUNX1     2-1251-003chr21:
36397623-36397623
GAintronicDe novo--Yuen2017 G
RUNX1     1-0051-005chr21:
36303866-36303866
AAGintronicDe novo--Yuen2017 G
RUNX1     2-0242-004chr21:
36437145-36437145
CGintergenicDe novo--Yuen2017 G
RUNX1     5-0040-003chr21:
36690008-36690008
TAintergenicDe novo--Yuen2017 G
RUNX1     AU4211304chr21:
36292592-36292592
TCintronicDe novo--Yuen2017 G
RUNX1     1-0585-003chr21:
36183250-36183250
CAintronicDe novo--Yuen2017 G
RUNX1     AU4444304chr21:
36247882-36247882
TAintronicDe novo--Yuen2017 G
RUNX1     1-0206-003chr21:
36658982-36658982
AAAGAATGintergenicDe novo--Yuen2017 G
RUNX1     1-0044-003chr21:
36303866-36303866
AAGintronicDe novo--Yuen2017 G
RUNX1     AU065807chr21:
36512080-36512080
GTintergenicDe novo--Yuen2017 G
RUNX1     AU070703chr21:
36593990-36593990
TCintergenicDe novo--Yuen2017 G
RUNX1     2-1620-003chr21:
36296195-36296195
AATintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More