or
or
Exact

Results for "PPFIA2"

Variant Events: 32

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
PPFIA2     1-0285-004chr12:
82151423-82151423
CTintronicDe novo--Yuen2017 G
PPFIA2     AU4310301chr12:
81935547-81935547
GAintronicDe novo--Yuen2017 G
PPFIA2     1-0186-004chr12:
81772223-81772223
CTintronicDe novo--Yuen2017 G
PPFIA2     1-0274-004chr12:
82255934-82255934
CTintergenicDe novo--Yuen2017 G
PPFIA2     2-0713-003chr12:
82165887-82165887
CGintergenicDe novo--Yuen2017 G
PPFIA2     1-0606-003chr12:
81819495-81819509
ACTCTCTCTCTCTCTACTCTCTCTCTCTintronicDe novo--Yuen2017 G
PPFIA2     2-0145-004chr12:
82220312-82220312
AATCintergenicDe novo--Yuen2017 G
PPFIA2     AU058103chr12:
81954643-81954643
AGintronicDe novo--Yuen2017 G
PPFIA2     AU4015301chr12:
81651348-81651348
CTdownstreamDe novo--Yuen2017 G
PPFIA2     7-0119-003chr12:
82249732-82249732
GAintergenicDe novo--Yuen2017 G
PPFIA2     AU2863302chr12:
81857394-81857394
GAintronicDe novo--Yuen2017 G
PPFIA2     AU2863302chr12:
82102717-82102719
TAATAintronicDe novo--Yuen2017 G
PPFIA2     AU3637301chr12:
82008058-82008058
CTintronicDe novo--Yuen2017 G
PPFIA2     2-1129-003chr12:
82252289-82252289
TAintergenicDe novo--Yuen2016 G
Yuen2017 G
PPFIA2     2-1689-003chr12:
81831070-81831070
GAintronicDe novo--Yuen2017 G
PPFIA2     AU3617302chr12:
82215797-82215797
GAintergenicDe novo--Yuen2017 G
PPFIA2     2-1336-004chr12:
82046723-82046723
TGintronicDe novo--Yuen2017 G
PPFIA2     2-0045-003chr12:
82307284-82307284
CAintergenicDe novo--Yuen2016 G
Yuen2017 G
PPFIA2     1-0609-003chr12:
81909735-81909735
CTintronicDe novo--Yuen2017 G
PPFIA2     AU075803chr12:
82049109-82049109
AGintronicDe novo--Yuen2017 G
PPFIA2     1-0252-003chr12:
81798488-81798488
CTintronicDe novo--Yuen2017 G
PPFIA2     AU048206chr12:
81760301-81760301
ATintronicDe novo--Yuen2017 G
PPFIA2     2-1295-003chr12:
82087722-82087722
TCintronicDe novo--Yuen2017 G
PPFIA2     1-0393-003chr12:
82117545-82117551
GCTCACTGCTintronicDe novo--Yuen2017 G
PPFIA2     2-0126-004chr12:
82144340-82144340
CGintronicDe novo--Yuen2017 G
PPFIA2     1-0393-003chr12:
81742255-81742255
GTintronicDe novo--Yuen2017 G
PPFIA2     AU066403chr12:
81886484-81886484
GAintronicDe novo--Yuen2017 G
PPFIA2     1-0285-003chr12:
82151423-82151423
CTintronicDe novo--Yuen2017 G
PPFIA2     AU049304chr12:
81980109-81980109
AGintronicDe novo--Yuen2017 G
PPFIA2     AU4235302chr12:
82184741-82184741
GTintergenicDe novo--Yuen2017 G
PPFIA2     2-1431-003chr12:
82250813-82250813
GTintergenicDe novo--Yuen2017 G
PPFIA2     AU015903chr12:
81728552-81728552
GAintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More