or
or
Exact

Results for "CALN1"

Variant Events: 48

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
CALN1     2-1105-003chr7:
72028734-72028734
CAintergenicDe novo--Yuen2016 G
Yuen2017 G
CALN1     1-0388-003chr7:
72008554-72008554
CTintergenicDe novo--Yuen2017 G
CALN1     1-0433-004chr7:
71329754-71329754
ACintronicDe novo--Yuen2017 G
CALN1     AC02-1197-01chr7:
71488801-71488801
ACintronicDe novo-0.0038Kosmicki2017 E
CALN1     2-1355-004chr7:
71525325-71525325
TCintronicDe novo--Yuen2017 G
CALN1     1-0286-004chr7:
71907817-71907817
GGCACTTTATGTAGGGTTGCAintergenicDe novo--Yuen2017 G
CALN1     2-0319-003chr7:
71605400-71605400
CAintronicDe novo--Yuen2017 G
CALN1     2-0003-003chr7:
71674023-71674023
CCCTintronicDe novo--Yuen2017 G
CALN1     2-1305-003chr7:
71562061-71562061
GAintronicDe novo--Yuen2017 G
CALN1     3-0436-000chr7:
71374017-71374017
GAintronicDe novo--Yuen2016 G
Yuen2017 G
CALN1     AU4410302chr7:
71786418-71786418
CAintronicDe novo--Yuen2017 G
CALN1     ASC_CA_58_Achr7:
71571306-71571306
AGintronicDe novo--Satterstrom2020 E
CALN1     1-0465-003achr7:
71625643-71625643
TCintronicDe novo--Yuen2017 G
CALN1     2-1510-003chr7:
71309600-71309600
GAintronicDe novo--Yuen2017 G
CALN1     AU030703chr7:
71628930-71628944
GAAGAAAGAAAGAAAGAAGAAAGAAAintronicDe novo--Yuen2017 G
CALN1     3-0169-000chr7:
71588127-71588127
CTintronicDe novo--Yuen2016 G
CALN1     14590.p1chr7:
71343977-71343977
CTintronicDe novo--Turner2016 G
CALN1     AU3399302chr7:
71841475-71841482
TACTGACTTACTintronicDe novo--Yuen2017 G
CALN1     14143.p1chr7:
71252912-71252912
GAintronicDe novo--Satterstrom2020 E
CALN1     2-1644-003chr7:
71866925-71866925
TCintronicDe novo--Yuen2017 G
CALN1     AU3053302chr7:
71810016-71810018
CATCintronicDe novo--Yuen2017 G
CALN1     AU3713302chr7:
71777248-71777248
GTintronicDe novo--Yuen2017 G
CALN1     1-0150-004chr7:
71380383-71380383
ACintronicDe novo--Yuen2017 G
CALN1     AU1542301chr7:
71557416-71557416
CTintronicDe novo--Yuen2017 G
CALN1     2-1308-003chr7:
71773550-71773550
GAintronicDe novo--Yuen2016 G
Yuen2017 G
CALN1     AU3190305chr7:
71737747-71737747
TCintronicDe novo--Yuen2017 G
CALN1     3-0439-000chr7:
71657040-71657040
CTintronicDe novo--Yuen2016 G
CALN1     1-0567-003chr7:
71319276-71319276
CTintronicDe novo--Yuen2017 G
CALN1     1-0632-003chr7:
71616567-71616568
CTCintronicDe novo--Yuen2017 G
CALN1     2-1397-003chr7:
71997022-71997022
CTintergenicDe novo--Yuen2017 G
CALN1     AU1448301chr7:
71842908-71842908
CGintronicDe novo--Yuen2017 G
CALN1     7-0179-003chr7:
71403851-71403851
ATintronicDe novo--Yuen2017 G
CALN1     1-0025-004chr7:
71673946-71673946
CAintronicPaternal--Yuen2017 G
CALN1     1-0025-006chr7:
71673946-71673946
CAintronicPaternal--Yuen2017 G
CALN1     1-0126-004chr7:
71688066-71688066
CGintronicDe novo--Yuen2017 G
CALN1     5-0138-003chr7:
71731769-71731769
GAintronicDe novo--Yuen2017 G
CALN1     AU4092302chr7:
71701835-71701835
TCintronicDe novo--Yuen2017 G
CALN1     1-0901-004chr7:
71626582-71626582
TCintronicDe novo--Yuen2017 G
CALN1     1-0160-004chr7:
71839612-71839612
CTintronicDe novo--Yuen2017 G
CALN1     2-1288-003chr7:
71394972-71394972
GAintronicDe novo--Yuen2017 G
CALN1     2-1509-003chr7:
71853685-71853700
CAGAGAGAGAGAGAGACAGAGAGAGAGAGAintronicDe novo--Yuen2017 G
CALN1     2-1265-003chr7:
71630869-71630869
CTintronicDe novo--Yuen2016 G
Yuen2017 G
CALN1     AU0452304chr7:
71764275-71764275
ATintronicDe novo--Yuen2017 G
CALN1     1-0465-003chr7:
71625643-71625643
TCintronicDe novo--Yuen2017 G
CALN1     2-1305-003chr7:
71940668-71940668
TAintergenicDe novo--Yuen2016 G
Yuen2017 G
CALN1     2-1466-003chr7:
71891240-71891240
AGintergenicDe novo--Yuen2016 G
Yuen2017 G
CALN1     2-1721-003chr7:
71312372-71312372
CTintronicDe novo--Yuen2017 G
CALN1     iHART2999chr7:
71868249-71868249
CCGGexonicMaternalframeshift insertionNM_031468c.105_106insCCp.D36fs--Ruzzo2019 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More