or
or
Exact

Results for "NUDT12"

Variant Events: 66

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
NUDT12     AU045514chr5:
103164603-103164603
CTintergenicDe novo--Yuen2017 G
NUDT12     7-0273-003chr5:
102980011-102980011
CGintergenicDe novo--Yuen2017 G
NUDT12     5-0014-004chr5:
104076349-104076349
GAintergenicDe novo--Yuen2017 G
NUDT12     1-0597-003chr5:
104329734-104329734
CGintergenicDe novo--Yuen2017 G
NUDT12     2-1329-003chr5:
103714290-103714290
CTintergenicDe novo--Yuen2016 G
Yuen2017 G
NUDT12     AU2293302chr5:
104431806-104431806
TCintergenicDe novo--Yuen2017 G
NUDT12     1-0282-003chr5:
103663959-103663978
GTTTATTGTGGAGTTCATGCGintergenicDe novo--Yuen2017 G
NUDT12     AU0540301chr5:
103461573-103461573
CTintergenicDe novo--Yuen2017 G
NUDT12     AU2950301chr5:
104346886-104346886
AGintergenicDe novo--Yuen2017 G
NUDT12     AU2988302chr5:
104264707-104264707
GAintergenicDe novo--Yuen2017 G
NUDT12     AU4089302chr5:
103246987-103246987
GAintergenicDe novo--Yuen2017 G
NUDT12     2-0145-004chr5:
104296513-104296513
ATintergenicDe novo--Yuen2017 G
NUDT12     2-0323-004chr5:
103178612-103178612
GAintergenicDe novo--Yuen2017 G
NUDT12     AU4173301chr5:
103267631-103267636
AATGATAATintergenicDe novo--Yuen2017 G
NUDT12     2-1619-003chr5:
103284921-103284926
ATGTATAintergenicDe novo--Yuen2017 G
NUDT12     2-1308-003chr5:
104179763-104179763
CAintergenicDe novo--Yuen2016 G
Yuen2017 G
NUDT12     AU4412302chr5:
103574941-103574941
CTintergenicDe novo--Yuen2017 G
NUDT12     AU1988301chr5:
103974479-103974479
AGintergenicDe novo--Yuen2017 G
NUDT12     AU071804chr5:
103036964-103036978
AAGAGAGAGAGAGAGAAGAGAGAGAGAGintergenicDe novo--Yuen2017 G
NUDT12     AU058103chr5:
103631614-103631614
CTintergenicDe novo--Yuen2017 G
NUDT12     AU3605303chr5:
103739452-103739452
GAintergenicDe novo--Yuen2017 G
NUDT12     1-0330-003chr5:
103505574-103505574
TAintergenicDe novo--Yuen2017 G
NUDT12     1-0233-004chr5:
103907870-103907870
GTintergenicDe novo--Yuen2017 G
NUDT12     AU038204chr5:
104252293-104252293
TCintergenicDe novo--Yuen2017 G
NUDT12     AU057404chr5:
103705954-103705954
GAintergenicDe novo--Yuen2017 G
NUDT12     AU076808chr5:
103098881-103098881
TCintergenicDe novo--Yuen2017 G
NUDT12     AU017304chr5:
104205972-104205972
GAintergenicDe novo--Yuen2017 G
NUDT12     1-0044-003chr5:
104064553-104064553
TCintergenicDe novo--Yuen2017 G
NUDT12     2-1361-003chr5:
103184028-103184028
GAintergenicDe novo--Yuen2016 G
NUDT12     3-0436-000chr5:
103472483-103472483
GCintergenicDe novo--Yuen2016 G
Yuen2017 G
NUDT12     2-0063-003chr5:
103215435-103215435
GAintergenicDe novo--Yuen2017 G
NUDT12     A30chr5:
102955738-102955738
CTintergenicDe novo--Wu2018 G
NUDT12     2-1295-003chr5:
103351370-103351371
CACintergenicDe novo--Yuen2016 G
Yuen2017 G
NUDT12     1-0277-003chr5:
104129174-104129174
AGintergenicDe novo--Yuen2016 G
Yuen2017 G
NUDT12     2-1246-003chr5:
103587409-103587414
TTTTCATintergenicDe novo--Yuen2017 G
NUDT12     2-1357-004chr5:
103605871-103605871
TAintergenicDe novo--Yuen2017 G
NUDT12     AU2951303chr5:
103821813-103821813
CTintergenicDe novo--Yuen2017 G
NUDT12     AU2988303chr5:
104264707-104264707
GAintergenicDe novo--Yuen2017 G
NUDT12     2-1522-003chr5:
103993027-103993027
CGintergenicDe novo--Yuen2017 G
NUDT12     7-0012-003chr5:
104391578-104391578
CAintergenicDe novo--Yuen2017 G
NUDT12     1-0701-003chr5:
103110443-103110443
CTintergenicDe novo--Yuen2017 G
NUDT12     14223.p1chr5:
102890586-102890586
GAintronicDe novo--Satterstrom2020 E
NUDT12     AU2458302chr5:
103538523-103538523
AGintergenicDe novo--Yuen2017 G
NUDT12     2-0002-005chr5:
103475574-103475574
CTintergenicDe novo--Yuen2017 G
NUDT12     AU2951302chr5:
103821813-103821813
CTintergenicDe novo--Yuen2017 G
NUDT12     AU3891303chr5:
103705708-103705708
CTintergenicDe novo--Yuen2017 G
NUDT12     1-0246-005chr5:
103767602-103767602
GAintergenicDe novo--Yuen2017 G
NUDT12     AU3727302chr5:
103287470-103287470
TGintergenicDe novo--Yuen2017 G
NUDT12     1-0359-003chr5:
104100956-104100956
TCintergenicDe novo--Yuen2017 G
NUDT12     1-0526-003chr5:
103294513-103294513
GGATintergenicDe novo--Yuen2017 G
NUDT12     1-0022-004chr5:
103415133-103415133
GAintergenicDe novo--Yuen2017 G
NUDT12     1-0079-008chr5:
103099850-103099850
CTintergenicDe novo--Yuen2017 G
NUDT12     AU066818chr5:
104282976-104282976
CAintergenicDe novo--Yuen2017 G
NUDT12     2-1267-003chr5:
103781737-103781737
CCTATintergenicDe novo--Yuen2017 G
NUDT12     7-0148-003chr5:
103073859-103073859
GAintergenicDe novo--Yuen2017 G
NUDT12     2-0289-003chr5:
104379414-104379414
CTintergenicDe novo--Yuen2017 G
NUDT12     2-0244-003chr5:
103203994-103203994
GCintergenicDe novo--Yuen2017 G
NUDT12     2-1005-003chr5:
103284872-103284872
ATintergenicDe novo--Yuen2017 G
NUDT12     2-1153-003chr5:
104275935-104275935
CAintergenicDe novo--Yuen2016 G
Yuen2017 G
NUDT12     AU1995302chr5:
104338727-104338727
CGintergenicDe novo--Yuen2017 G
NUDT12     1-0552-003chr5:
103375992-103375992
ACintergenicDe novo--Yuen2017 G
NUDT12     2-1353-003chr5:
103130478-103130478
CTintergenicDe novo--Yuen2016 G
Yuen2017 G
NUDT12     1-0593-003chr5:
104349333-104349333
CTintergenicDe novo--Yuen2017 G
NUDT12     AU3865301chr5:
104211875-104211875
TCintergenicDe novo--Yuen2017 G
NUDT12     AU3997302chr5:
103295428-103295437
AGATCTGTGAAGAintergenicDe novo--Yuen2017 G
NUDT12     AU058104chr5:
103846155-103846155
GAintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More