or
or
Exact

Results for "IRX1"

Variant Events: 68

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
IRX1     14015.p1chr5:
4411932-4411932
GAintergenicDe novo--Turner2016 G
IRX1     2-1461-003chr5:
3597126-3597126
TCintronicDe novo--Yuen2016 G
Yuen2017 G
IRX1     AU3885304chr5:
4321427-4321427
CAintergenicDe novo--Yuen2017 G
IRX1     2-0319-003chr5:
4368098-4368098
TCintergenicDe novo--Yuen2017 G
IRX1     12568.p1chr5:
3798319-3798319
CTintergenicDe novo--Turner2016 G
IRX1     AU3787302chr5:
3660276-3660276
GTintergenicDe novo--Yuen2017 G
IRX1     2-1337-003chr5:
4586404-4586420
TTCTCTCTCTCTCTCTCTTCTCTCTCTCTCTCintergenicDe novo--Yuen2017 G
IRX1     AU4264302chr5:
4150615-4150615
TAintergenicDe novo--Yuen2017 G
IRX1     AU057405chr5:
4549197-4549197
CTintergenicDe novo--Yuen2017 G
IRX1     2-1411-003chr5:
4017846-4017846
CTintergenicDe novo--Yuen2017 G
IRX1     2-1487-003chr5:
4390767-4390767
CTintergenicDe novo--Yuen2017 G
IRX1     AU4283301chr5:
3715535-3715535
CTintergenicDe novo--Yuen2017 G
IRX1     AU3862305chr5:
4450602-4450602
TGintergenicDe novo--Yuen2017 G
IRX1     1-0551-004chr5:
4121771-4121771
GTintergenicDe novo--Yuen2017 G
IRX1     2-1437-003chr5:
4119853-4119853
CCTTintergenicDe novo--Yuen2017 G
IRX1     AU4376301chr5:
3754206-3754206
AGintergenicDe novo--Yuen2017 G
IRX1     1-0448-003chr5:
4530563-4530563
CTintergenicDe novo--Yuen2017 G
IRX1     2-0158-003chr5:
4460856-4460856
ACintergenicDe novo--Yuen2017 G
IRX1     2-1502-003chr5:
3793182-3793182
GAintergenicDe novo--Yuen2017 G
IRX1     AU4154303chr5:
4335364-4335364
TAintergenicDe novo--Yuen2017 G
IRX1     AU3875301chr5:
4165808-4165808
CGintergenicDe novo--Yuen2017 G
IRX1     1-0255-003chr5:
4188592-4188592
GAintergenicDe novo--Yuen2016 G
Yuen2017 G
IRX1     1-0255-003chr5:
4188594-4188594
CAintergenicDe novo--Yuen2017 G
IRX1     2-1502-003chr5:
4261385-4261385
GAintergenicDe novo--Yuen2017 G
IRX1     AU4186302chr5:
3862516-3862516
CTintergenicDe novo--Yuen2017 G
IRX1     AU4429301chr5:
3983666-3983666
TCintergenicDe novo--Yuen2017 G
IRX1     2-0068-003chr5:
3710100-3710100
GTintergenicDe novo--Yuen2017 G
IRX1     AU1308303chr5:
4348500-4348500
CAintergenicDe novo--Yuen2017 G
IRX1     2-0297-003chr5:
4618390-4618390
CTintergenicDe novo--Yuen2017 G
IRX1     2-1132-003chr5:
3955753-3955753
AAGACintergenicDe novo--Yuen2017 G
IRX1     1-0757-003chr5:
3827894-3827894
CTintergenicDe novo--Yuen2017 G
IRX1     AU062204chr5:
3660276-3660276
GTintergenicDe novo--Yuen2017 G
IRX1     1-0570-003chr5:
4104913-4104913
CTintergenicDe novo--Yuen2017 G
IRX1     1-0186-005chr5:
3740332-3740334
CAGCintergenicDe novo--Yuen2017 G
IRX1     1-0609-003chr5:
4514489-4514489
AGintergenicDe novo--Yuen2017 G
IRX1     1-0507-003chr5:
4271412-4271412
CAintergenicDe novo--Yuen2016 G
Yuen2017 G
IRX1     1-0560-003chr5:
4261594-4261611
ATGTGTGTGTGTGTGTGTATGTGTGTGTGTGTGTintergenicDe novo--Yuen2017 G
IRX1     AU3632301chr5:
3960153-3960153
CTintergenicDe novo--Yuen2017 G
IRX1     1-0994-003chr5:
3599264-3599280
GTCTCTCTCTCTCTCTCGTCTCTCTCTCTCTCintronicDe novo--Yuen2017 G
IRX1     1-0466-003chr5:
3697241-3697241
AGintergenicDe novo--Yuen2017 G
IRX1     AU056804chr5:
4149314-4149314
TAintergenicDe novo--Yuen2017 G
IRX1     5-0077-003chr5:
4688364-4688369
TGAACATintergenicDe novo--Yuen2017 G
IRX1     1-0153-005chr5:
3804404-3804404
TCintergenicDe novo--Yuen2017 G
IRX1     2-1169-004chr5:
3677258-3677258
ATintergenicDe novo--Yuen2017 G
IRX1     AU1940304chr5:
3881778-3881778
GAintergenicDe novo--Yuen2017 G
IRX1     AU046904chr5:
4595072-4595072
GTintergenicDe novo--Yuen2017 G
IRX1     1-0054-003chr5:
4504923-4504923
GAintergenicDe novo--Yuen2017 G
IRX1     AU4223302chr5:
4182972-4182972
AGintergenicDe novo--Yuen2017 G
IRX1     2-1437-004chr5:
4119853-4119853
CCTTintergenicDe novo--Yuen2017 G
IRX1     2-1169-004chr5:
4219652-4219652
AGintergenicDe novo--Yuen2017 G
IRX1     2-0323-003chr5:
4691350-4691350
GCintergenicDe novo--Yuen2017 G
IRX1     AU2022302chr5:
4530123-4530123
GTintergenicDe novo--Yuen2017 G
IRX1     2-1297-004chr5:
4305146-4305146
TCintergenicDe novo--Yuen2017 G
IRX1     5-0077-004chr5:
4688364-4688369
TGAACATintergenicDe novo--Yuen2017 G
IRX1     3-0065-000chr5:
4643298-4643298
GTintergenicDe novo--Yuen2017 G
IRX1     1-0604-003chr5:
4187701-4187701
GAintergenicDe novo--Yuen2017 G
IRX1     AU3051303chr5:
3722761-3722761
TCintergenicDe novo--Yuen2017 G
IRX1     AU3951301chr5:
4231957-4231957
GCintergenicDe novo--Yuen2017 G
IRX1     2-1350-003chr5:
3931988-3931988
CTintergenicDe novo--Yuen2017 G
IRX1     AU4069302chr5:
3977408-3977408
TCintergenicDe novo--Yuen2017 G
IRX1     2-1426-003chr5:
4134857-4134857
TCintergenicDe novo--Yuen2017 G
IRX1     AU066818chr5:
4696108-4696108
CTintergenicDe novo--Yuen2017 G
IRX1     1-0197-003chr5:
4107087-4107087
TCintergenicDe novo--Yuen2017 G
IRX1     AU4056301chr5:
4721324-4721324
AGintergenicDe novo--Yuen2017 G
IRX1     1-0218-004chr5:
4610336-4610336
AGintergenicDe novo--Yuen2017 G
IRX1     2-1153-003chr5:
4098175-4098175
GAintergenicDe novo--Yuen2016 G
Yuen2017 G
IRX1     2-1184-003chr5:
3874283-3874283
GCintergenicDe novo--Yuen2017 G
IRX1     AU3716301chr5:
4232423-4232423
TGintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More