or
or
Exact

Results for "BMP2"

Variant Events: 24

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
BMP2     2-1296-003chr20:
6929610-6929610
TCintergenicDe novo--Yuen2017 G
BMP2     2-1358-003chr20:
6801051-6801051
ACintergenicDe novo--Yuen2017 G
BMP2     2-1360-003chr20:
7024054-7024054
ACintergenicDe novo--Yuen2016 G
Yuen2017 G
BMP2     AU056003chr20:
6766649-6766649
GTintergenicDe novo--Yuen2017 G
BMP2     AU4007302chr20:
6983834-6983834
TCintergenicDe novo--Yuen2017 G
BMP2     2-1153-003chr20:
6862958-6862958
CTintergenicDe novo--Yuen2016 G
Yuen2017 G
BMP2     AU3900301chr20:
6809660-6809660
TGintergenicDe novo--Yuen2017 G
BMP2     2-1362-004chr20:
6848577-6848577
AGintergenicDe novo--Yuen2017 G
BMP2     1-0551-003chr20:
7041295-7041295
AGintergenicDe novo--Yuen2017 G
BMP2     13143.p1chr20:
6750882-6750882
TGexonicDe novononsynonymous SNVNM_001200c.T109Gp.S37A0.3240.0379Wilfert2021 G
BMP2     1-0051-005chr20:
6897383-6897395
ATAAGCTCTTCATAintergenicDe novo--Yuen2017 G
BMP2     AU4027306chr20:
7038511-7038511
CTintergenicDe novo--Yuen2017 G
BMP2     1-0051-004chr20:
6897383-6897395
ATAAGCTCTTCATAintergenicDe novo--Yuen2017 G
BMP2     1-0757-003chr20:
7043369-7043369
AGintergenicDe novo--Yuen2017 G
BMP2     2-1526-004chr20:
7025375-7025375
GAintergenicDe novo--Yuen2017 G
BMP2     AU1909304chr20:
6810167-6810167
GTintergenicDe novo--Yuen2017 G
BMP2     AU3051303chr20:
7091385-7091385
CTintergenicDe novo--Yuen2017 G
BMP2     AU4029301chr20:
7117200-7117200
AGintergenicDe novo--Yuen2017 G
BMP2     1-0627-005chr20:
6927579-6927579
TGintergenicDe novo--Yuen2017 G
BMP2     2-1738-003chr20:
7084583-7084635
CTGGTGATGACCTTTCTGTAGTCCTCTTGGTGATAACCTTTCTGTAGTCCTCTCTGGTGATAACCTTTCTGTAGTCCTCTintergenicDe novo--Yuen2017 G
BMP2     AU4433301chr20:
6943681-6943681
ACintergenicDe novo--Yuen2017 G
BMP2     AU4372309chr20:
6782199-6782199
TCintergenicDe novo--Yuen2017 G
BMP2     14349.p1chr20:
6750932-6750932
CTexonicDe novosynonymous SNVNM_001200c.C159Tp.F53F--Krumm2015 E
Lim2017 E
Satterstrom2020 E
BMP2     1-0998-003chr20:
6890681-6890691
AAGAGAGAGAGAAGAGAGAGAGAGintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More