or
or
Exact

Results for "RFC3"

Variant Events: 28

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
RFC3     1-0338-003chr13:
34493332-34493332
CTintronicDe novo--Yuen2017 G
RFC3     1-0627-005chr13:
34770743-34770749
ATTTTTTATTTTTTTintergenicDe novo--Yuen2017 G
RFC3     AU2427303chr13:
34619309-34619309
AGintergenicDe novo--Yuen2017 G
RFC3     iHART2255chr13:
34400003-34400005
ACTAexonicPaternalframeshift deletionNM_002915
NM_181558
c.372_373del
c.372_373del
p.N124fs
p.N124fs
-2.508E-5Ruzzo2019 G
RFC3     iHART2259chr13:
34399945-34399945
CTexonicPaternalstopgainNM_002915
NM_181558
c.C313T
c.C313T
p.R105X
p.R105X
38.01.0E-4Ruzzo2019 G
RFC3     iHART2253chr13:
34400003-34400005
ACTAexonicPaternalframeshift deletionNM_002915
NM_181558
c.372_373del
c.372_373del
p.N124fs
p.N124fs
-2.508E-5Ruzzo2019 G
RFC3     AU073005chr13:
34635060-34635060
TCintergenicDe novo--Yuen2017 G
RFC3     2-1215-003chr13:
34711477-34711477
TGintergenicDe novo--Yuen2017 G
RFC3     2-1153-003chr13:
34609129-34609129
CTintergenicDe novo--Yuen2016 G
Yuen2017 G
RFC3     5-0087-003chr13:
34854212-34854212
CTintergenicDe novo--Yuen2017 G
RFC3     AU3912302chr13:
34965775-34965775
GCintergenicDe novo--Yuen2017 G
RFC3     AU1687303chr13:
34944426-34944426
TAintergenicDe novo--Yuen2017 G
RFC3     7-0174-003chr13:
34567446-34567446
TCintergenicDe novo--Yuen2017 G
RFC3     2-0197-004chr13:
34793855-34793855
GCintergenicDe novo--Yuen2017 G
RFC3     2-0219-004chr13:
34570615-34570615
CTintergenicDe novo--Yuen2017 G
RFC3     7-0068-003chr13:
34909912-34909912
GAintergenicDe novo--Yuen2017 G
RFC3     2-0305-003chr13:
34652931-34652931
TTGTGTGTGCATCAATGTGTGTATATGTGTGAATGAintergenicDe novo--Yuen2017 G
RFC3     5-0018-003chr13:
34737328-34737328
GGGCATintergenicDe novo--Yuen2017 G
RFC3     AU3725302chr13:
34648838-34648838
AGintergenicDe novo--Yuen2017 G
RFC3     3-0391-000chr13:
34859516-34859516
CAintergenicDe novo--Yuen2017 G
RFC3     AU2248302chr13:
34733345-34733345
CTintergenicDe novo--Yuen2017 G
RFC3     AU4476302chr13:
34649081-34649081
AGintergenicDe novo--Yuen2017 G
RFC3     5-0071-003chr13:
34419379-34419379
GAintronicDe novo--Yuen2017 G
RFC3     AU4013303chr13:
34781518-34781518
CAintergenicDe novo--Yuen2017 G
RFC3     AU1894304chr13:
34417912-34417912
CTintronicDe novo--Yuen2017 G
RFC3     AU1687302chr13:
34944426-34944426
TAintergenicDe novo--Yuen2017 G
RFC3     1-0305-004chr13:
34958347-34958347
CTintergenicDe novo--Yuen2017 G
RFC3     AU3586303chr13:
34460208-34460209
ACAintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More