or
or
Exact

Results for "BCHE"

Variant Events: 78

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
BCHE     2-1626-003chr3:
165540005-165540026
TATGAATGAATGAATGAATGAATATGAATGAATGAATGAAintronicDe novo--Yuen2017 G
BCHE     1-0465-003achr3:
165886473-165886473
TCintergenicDe novo--Yuen2017 G
BCHE     AU3849303chr3:
166660269-166660269
CTintergenicDe novo--Yuen2017 G
BCHE     1-0804-003chr3:
166481921-166481921
AGintergenicDe novo--Yuen2017 G
BCHE     AU3702306chr3:
165973686-165973686
GCintergenicDe novo--Yuen2017 G
BCHE     SSC07880chr3:
165547525-165547525
ACexonicDe novononsynonymous SNVNM_000055c.T1297Gp.F433V11.96-Lim2017 E
BCHE     AU3649305chr3:
166853247-166853247
TCintergenicDe novo--Yuen2017 G
BCHE     2-0110-003chr3:
166736213-166736213
GAintergenicDe novo--Yuen2017 G
BCHE     AU060004chr3:
165705796-165705796
AGintergenicDe novo--Yuen2017 G
BCHE     3C575chr3:
165503957-165503957
ATexonicDe novononsynonymous SNVNM_000055c.T1660Ap.F554I13.39-Satterstrom2020 E
BCHE     13580.p1chr3:
165547525-165547525
ACexonicDe novononsynonymous SNVNM_000055c.T1297Gp.F433V11.96-Iossifov2012 E
Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Satterstrom2020 E
BCHE     1-0323-004chr3:
166391397-166391397
AGintergenicDe novo--Yuen2017 G
BCHE     2-1066-004chr3:
166422794-166422802
TGCTTCCAATintergenicDe novo--Yuen2017 G
BCHE     5-0106-003chr3:
166245593-166245597
TTGTGTTGintergenicDe novo--Yuen2017 G
BCHE     AU4154303chr3:
165994111-165994111
CAintergenicDe novo--Yuen2017 G
BCHE     AU071204chr3:
166459833-166459833
CTintergenicDe novo--Yuen2017 G
BCHE     1-0339-003chr3:
165966945-165966951
GGCTCAAGintergenicDe novo--Yuen2017 G
BCHE     2-1456-004chr3:
166646088-166646088
AATCintergenicDe novo--Yuen2017 G
BCHE     1-0181-004chr3:
166163230-166163232
GAAGAintergenicDe novo--Yuen2017 G
BCHE     2-1163-003chr3:
165582258-165582258
CTintergenicDe novo--Yuen2016 G
Yuen2017 G
BCHE     AU4239301chr3:
166636987-166636988
ATAintergenicDe novo--Yuen2017 G
BCHE     2-1281-003chr3:
166063067-166063067
CTintergenicDe novo--Yuen2017 G
BCHE     AU1909304chr3:
165862455-165862455
AGintergenicDe novo--Yuen2017 G
BCHE     AU3881302chr3:
166311726-166311726
GAintergenicDe novo--Yuen2017 G
BCHE     1-0465-003chr3:
165886473-165886473
TCintergenicDe novo--Yuen2017 G
BCHE     1-0901-004chr3:
166439140-166439140
AATCCintergenicDe novo--Yuen2017 G
BCHE     1-0367-003chr3:
166521795-166521795
GTintergenicDe novo--Yuen2017 G
BCHE     7-0104-003chr3:
166586734-166586734
GTintergenicDe novo--Yuen2017 G
BCHE     2-0297-003chr3:
165499622-165499622
ATintronicDe novo--Yuen2017 G
BCHE     1-0382-003chr3:
165966945-165966951
GGCTCAAGintergenicDe novo--Yuen2017 G
BCHE     2-0070-004chr3:
166250674-166250674
CAintergenicDe novo--Yuen2017 G
BCHE     1-0585-003chr3:
165956823-165956823
ACintergenicDe novo--Yuen2017 G
BCHE     1-0203-003chr3:
166901268-166901268
CTintergenicDe novo--Yuen2017 G
BCHE     1-0560-003chr3:
165900704-165900704
GAintergenicDe novo--Yuen2017 G
BCHE     2-0045-003chr3:
165816380-165816380
GTintergenicDe novo--Yuen2016 G
Yuen2017 G
BCHE     AU056003chr3:
165490073-165490073
CTdownstreamDe novo--Yuen2017 G
BCHE     AU3866301chr3:
165747608-165747608
CTintergenicDe novo--Yuen2017 G
BCHE     AU056003chr3:
166529083-166529083
GAintergenicDe novo--Yuen2017 G
BCHE     74-0115chr3:
165645967-165645967
CAintergenicDe novo--Michaelson2012 G
BCHE     AU2089301chr3:
166939549-166939550
ATAintergenicDe novo--Yuen2017 G
BCHE     74-0075chr3:
166468365-166468365
TCintergenicDe novo--Michaelson2012 G
BCHE     2-0270-003chr3:
166896401-166896401
AGintergenicDe novo--Yuen2017 G
BCHE     5-0041-003chr3:
166056763-166056763
TAintergenicDe novo--Yuen2017 G
BCHE     1-0627-003chr3:
166912980-166912980
GTintergenicDe novo--Yuen2017 G
BCHE     AU007503chr3:
166468365-166468365
TCintergenicDe novo--Yuen2017 G
BCHE     AU3057302chr3:
166279396-166279396
CTintergenicDe novo--Yuen2017 G
BCHE     1-0466-003chr3:
165677018-165677018
GAintergenicDe novo--Yuen2017 G
BCHE     AU3807302chr3:
166590373-166590373
AGintergenicDe novo--Yuen2017 G
BCHE     2-0286-003chr3:
166285368-166285368
TCintergenicDe novo--Yuen2017 G
BCHE     1-0051-005chr3:
165697966-165697966
AACintergenicDe novo--Yuen2017 G
BCHE     2-1305-003 Complex Event; expand row to view variants  De novo--Yuen2016 G
Yuen2017 G
BCHE     AU050603chr3:
166043258-166043258
GAintergenicDe novo--Yuen2017 G
BCHE     1-0632-003chr3:
165973231-165973231
AATintergenicDe novo--Yuen2017 G
BCHE     AU3506303chr3:
166763954-166763955
GCGintergenicDe novo--Yuen2017 G
BCHE     1-0473-003chr3:
166790453-166790453
ATintergenicDe novo--Yuen2017 G
BCHE     AU009805chr3:
165748232-165748232
CGintergenicDe novo--Yuen2017 G
BCHE     1-0901-003chr3:
166439140-166439140
AATCCintergenicDe novo--Yuen2017 G
BCHE     AU3506303chr3:
166880077-166880077
GAintergenicDe novo--Yuen2017 G
BCHE     1-0841-003chr3:
165607279-165607279
CAintergenicDe novo--Yuen2017 G
BCHE     AU3051303chr3:
166839861-166839861
GAintergenicDe novo--Yuen2017 G
BCHE     AU2333302chr3:
166898444-166898444
TCintergenicDe novo--Yuen2017 G
BCHE     1-0353-003chr3:
165997250-165997250
GAintergenicDe novo--Yuen2017 G
BCHE     AU4159302chr3:
165827750-165827750
ATintergenicDe novo--Yuen2017 G
BCHE     AU2569301chr3:
166400941-166400941
AGintergenicDe novo--Yuen2017 G
BCHE     2-0289-003chr3:
166167607-166167607
GGTATintergenicDe novo--Yuen2017 G
BCHE     AU3398301chr3:
166635004-166635004
GAintergenicDe novo--Yuen2017 G
BCHE     14590.p1chr3:
166594979-166594979
CGintergenicDe novo--Turner2016 G
BCHE     2-1194-003chr3:
166904947-166904947
CGintergenicDe novo--Yuen2016 G
Yuen2017 G
BCHE     AU3997302chr3:
166454309-166454309
TGintergenicDe novo--Yuen2017 G
BCHE     1-0339-004chr3:
165966945-165966951
GGCTCAAGintergenicDe novo--Yuen2017 G
BCHE     2-1148-004chr3:
166295525-166295525
AGintergenicDe novo--Yuen2017 G
BCHE     AU4228302chr3:
166621769-166621769
ACintergenicDe novo--Yuen2017 G
BCHE     AU4234302chr3:
165922055-165922055
GAintergenicDe novo--Yuen2017 G
BCHE     2-1277-003chr3:
165871583-165871583
ATintergenicDe novo--Yuen2017 G
BCHE     1-0300-004chr3:
166081862-166081862
TCintergenicDe novo--Yuen2017 G
BCHE     2-1300-003chr3:
166832204-166832204
CGintergenicDe novo--Yuen2017 G
BCHE     1-0201-004chr3:
165654121-165654121
AGintergenicDe novo--Yuen2017 G
BCHE     AU4365302chr3:
166453221-166453221
AGintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More