or
or
Exact

Results for "DOCK10"

Variant Events: 37

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
DOCK10     13543.p1chr2:
225817038-225817038
CTintronicDe novo--Turner2016 G
DOCK10     AU1987301chr2:
225738140-225738140
ACintronicDe novo--Yuen2017 G
DOCK10     1-0158-012chr2:
225852914-225852914
CGintronicDe novo--Yuen2017 G
DOCK10     13023.p1chr2:
225820138-225820138
TCintronicDe novo--Turner2016 G
DOCK10     13023.p1chr2:
225820220-225820220
GCintronicDe novo--Turner2016 G
DOCK10     1-0261-004chr2:
226088134-226088138
GTCTTGintergenicDe novo--Yuen2017 G
DOCK10     AU025704chr2:
225861307-225861307
GAintronicDe novo--Yuen2017 G
DOCK10     1-0022-004chr2:
226184330-226184330
AGintergenicDe novo--Yuen2017 G
DOCK10     2-1306-004chr2:
225630400-225630400
AGUTR3De novo--Yuen2017 G
DOCK10     1-0274-004chr2:
225844332-225844332
CTintronicDe novo--Yuen2017 G
DOCK10     1-0338-003chr2:
225774528-225774528
GGTTTTGTTTTTTGTTTTTTGAintronicDe novo--Yuen2017 G
DOCK10     1-0531-003chr2:
226148277-226148277
GAintergenicDe novo--Yuen2016 G
Yuen2017 G
DOCK10     2-1368-003chr2:
225983859-225983859
CTintergenicDe novo--Yuen2017 G
DOCK10     7-0256-003chr2:
225996660-225996660
GAintergenicDe novo--Yuen2017 G
DOCK10     AU3906301chr2:
226080959-226080959
GAintergenicDe novo--Yuen2017 G
DOCK10     1-0323-003chr2:
225698675-225698675
AGintronicDe novo--Yuen2017 G
DOCK10     1-0441-003chr2:
225670816-225670816
TGintronicDe novo--Yuen2016 G
Yuen2017 G
DOCK10     1-0022-003chr2:
226184330-226184330
AGintergenicDe novo--Yuen2016 G
DOCK10     2-1306-003chr2:
225630400-225630400
AGUTR3De novo--Yuen2017 G
DOCK10     AU056604chr2:
225779701-225779701
AGintronicDe novo--Yuen2017 G
DOCK10     7-0141-003chr2:
225796866-225796866
AGintronicDe novo--Yuen2017 G
DOCK10     1-0274-003chr2:
225844332-225844332
CTintronicDe novo--Yuen2017 G
DOCK10     1-0065-005chr2:
226109155-226109155
TTAAACintergenicDe novo--Yuen2017 G
DOCK10     2-0045-003chr2:
226069324-226069324
GAintergenicDe novo--Yuen2016 G
Yuen2017 G
DOCK10     AU3857301chr2:
225638252-225638252
CAintronicDe novo--Yuen2017 G
DOCK10     PN400157chr2:
225721677-225721677
CTexonicUnknownnonsynonymous SNVNM_001290263
NM_014689
c.G1690A
c.G1708A
p.G564R
p.G570R
28.70.0073Leblond2019 E
DOCK10     AU3727303chr2:
225771449-225771449
GCintronicDe novo--Yuen2017 G
DOCK10     2-1429-003chr2:
225917272-225917272
TCintergenicDe novo--Yuen2017 G
DOCK10     AU047904chr2:
226067249-226067249
AGintergenicDe novo--Yuen2017 G
DOCK10     2-0238-003chr2:
225890318-225890318
TCintronicDe novo--Yuen2017 G
DOCK10     AU073006chr2:
226187912-226187912
GAintergenicDe novo--Yuen2017 G
DOCK10     1-0253-005chr2:
225720326-225720326
CAintronicDe novo--Yuen2017 G
DOCK10     1-0898-003chr2:
225677871-225677871
CTintronicDe novo--Yuen2017 G
DOCK10     AU3786301chr2:
226169455-226169455
CTintergenicDe novo--Yuen2017 G
DOCK10     1-0935-003chr2:
225714298-225714298
CTexonicDe novononsynonymous SNVNM_001290263
NM_014689
c.G2143A
c.G2161A
p.G715R
p.G721R
29.2-Yuen2017 G
DOCK10     1-0010-003chr2:
225808835-225808835
TCintronicDe novo--Yuen2017 G
DOCK10     1-0701-003chr2:
225689557-225689557
GCintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More