or
or
Exact

Results for "NTM"

Variant Events: 68

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
NTM     2-1163-003chr11:
131283350-131283350
CAintronicDe novo--Yuen2016 G
Yuen2017 G
NTM     2-1529-003chr11:
131753802-131753802
CTintronicDe novo--Yuen2017 G
NTM     2-0214-003chr11:
131790875-131790876
TATintronicDe novo--Yuen2017 G
NTM     AU3175303chr11:
131357971-131357972
TATAAintronicDe novo--Yuen2017 G
NTM     A21chr11:
131947891-131947891
ACintronicDe novo--Wu2018 G
NTM     AU3951301chr11:
132047970-132047970
TCintronicDe novo--Yuen2017 G
NTM     1-0051-005chr11:
131303042-131303042
CCGCCCGintronicDe novo--Yuen2017 G
NTM     5-0040-003chr11:
132200673-132200673
CAintronicDe novo--Yuen2017 G
NTM     A11chr11:
131513296-131513296
CTintronicDe novo--Wu2018 G
NTM     2-1152-003chr11:
132229500-132229500
CTintergenicDe novo--Yuen2016 G
Yuen2017 G
NTM     1-0441-003chr11:
132095336-132095336
ATintronicDe novo--Yuen2016 G
Yuen2017 G
NTM     1-0541-003chr11:
131352365-131352365
TGintronicDe novo--Yuen2017 G
NTM     3-0456-000chr11:
131719340-131719353
CGAGAGAGAGAGAGCGAGAGAGAGAGintronicDe novo--Yuen2017 G
NTM     AU2129301chr11:
131284612-131284612
GAintronicDe novo--Yuen2017 G
NTM     AU2410302chr11:
131813876-131813876
TCintronicDe novo--Yuen2017 G
NTM     AU4159302chr11:
131451689-131451689
GAintronicDe novo--Yuen2017 G
NTM     11002.p1chr11:
131605413-131605413
GAintronicDe novo--Turner2016 G
NTM     1-0403-004chr11:
131803466-131803466
CGintronicDe novo--Yuen2017 G
NTM     1-0465-003achr11:
131898655-131898655
AGintronicDe novo--Yuen2017 G
NTM     1-0763-004chr11:
132032529-132032529
GTintronicDe novo--Yuen2017 G
NTM     2-1086-003chr11:
131995612-131995612
GGTintronicDe novo--Yuen2017 G
NTM     AU4099301chr11:
131854785-131854785
GAintronicDe novo--Yuen2017 G
NTM     14621.p1chr11:
131475780-131475780
TGintronicDe novo--Wilfert2021 G
NTM     AU3634301chr11:
131684551-131684551
GAintronicDe novo--Yuen2017 G
NTM     2-1176-003chr11:
132036797-132036797
ATintronicDe novo--Yuen2017 G
NTM     1-0049-004chr11:
131552741-131552753
GCAGCCGCTGTTTGintronicDe novo--Yuen2017 G
NTM     2-1176-003chr11:
131751103-131751103
AGintronicDe novo--Yuen2017 G
NTM     3-0080-000chr11:
131784625-131784625
CTintronicDe novo--Yuen2016 G
Yuen2017 G
NTM     AU038703chr11:
131604885-131604885
CTintronicDe novo--Yuen2017 G
NTM     2-0012-004chr11:
131995600-131995600
TTAAintronicDe novo--Yuen2017 G
NTM     12321.p1chr11:
131373318-131373318
GAintronicDe novo--Werling2018 G
NTM     AU071804chr11:
131959026-131959026
GAintronicDe novo--Yuen2017 G
NTM     1-0320-004chr11:
131735696-131735696
AACACACTintronicDe novo--Yuen2017 G
NTM     2-1525-003chr11:
131289560-131289560
TCintronicDe novo--Yuen2017 G
NTM     5-0025-003chr11:
132184329-132184332
TATATintronicDe novo--Yuen2017 G
NTM     AU034904chr11:
131416223-131416223
GAintronicDe novo--Yuen2017 G
NTM     2-1296-003chr11:
131804403-131804403
TAintronicDe novo--Yuen2017 G
NTM     5-0050-004chr11:
131943025-131943025
ATintronicDe novo--Yuen2017 G
NTM     2-1525-003chr11:
132205331-132205331
GAUTR3De novo--Yuen2017 G
NTM     AU076508chr11:
131730884-131730884
CTintronicDe novo--Yuen2017 G
NTM     AU051503chr11:
131254058-131254058
AGintronicDe novo--Yuen2017 G
NTM     2-0256-004chr11:
131528450-131528450
CTintronicDe novo--Yuen2017 G
NTM     2-1358-003chr11:
131697127-131697127
CTintronicDe novo--Yuen2017 G
NTM     1-0495-003chr11:
131705554-131705554
CTintronicDe novo--Yuen2017 G
NTM     AU073005chr11:
132241265-132241265
CTintergenicDe novo--Yuen2017 G
NTM     1-0465-003chr11:
131898655-131898655
AGintronicDe novo--Yuen2017 G
NTM     2-1506-003chr11:
132165037-132165052
AACACACACACACACAAACACACACACACAintronicDe novo--Yuen2017 G
NTM     AU003405chr11:
131550290-131550296
TGTGCGTTGTintronicDe novo--Yuen2017 G
NTM     217-14304-3540chr11:
132177671-132177672
TGGexonicMaternalframeshift deletionNM_001144058
NM_001144059
NM_016522
NM_001048209
c.615delT
c.615delT
c.615delT
c.615delT
p.N205fs
p.N205fs
p.N205fs
p.N205fs
--Stessman2017 T
NTM     2-0142-003chr11:
131437632-131437632
CTintronicDe novo--Yuen2017 G
NTM     1-0497-003chr11:
131509775-131509775
GAintronicDe novo--Yuen2017 G
NTM     AU079104chr11:
131983951-131983951
AGintronicDe novo--Yuen2017 G
NTM     AU3912303chr11:
131298410-131298410
CTintronicDe novo--Yuen2017 G
NTM     AU4093304chr11:
132189292-132189292
GAintronicDe novo--Yuen2017 G
NTM     AU1860302chr11:
132165015-132165022
CTCTGTCTCTCTintronicDe novo--Yuen2017 G
NTM     2-1359-004chr11:
131735696-131735696
AACACACTintronicDe novo--Yuen2017 G
NTM     2-1365-003chr11:
131720535-131720535
CTintronicDe novo--Yuen2016 G
Yuen2017 G
NTM     2-0223-003chr11:
131867210-131867210
CAintronicDe novo--Yuen2017 G
NTM     3-0447-000chr11:
131698316-131698316
AGintronicDe novo--Yuen2016 G
Yuen2017 G
NTM     2-0210-004chr11:
131433603-131433603
ACintronicDe novo--Yuen2017 G
NTM     1-0482-003chr11:
131420608-131420608
TCintronicDe novo--Yuen2016 G
Yuen2017 G
NTM     A23chr11:
131648218-131648218
TGintronicDe novo--Wu2018 G
NTM     AU4197302chr11:
131605956-131605956
GCintronicDe novo--Yuen2017 G
NTM     2-0304-003chr11:
132079641-132079641
CTintronicDe novo--Yuen2017 G
NTM     AU3605304chr11:
131969927-131969927
CTintronicDe novo--Yuen2017 G
NTM     2-0304-003chr11:
132075074-132075074
CTintronicDe novo--Yuen2017 G
NTM     1-0206-004chr11:
132008644-132008644
ACintronicDe novo--Yuen2017 G
NTM     2-1207-003chr11:
131450712-131450712
GTintronicDe novo--Yuen2016 G
Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More