or
or
Exact

Results for "LINC01060"

Variant Events: 86

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
LINC01060     2-1230-003chr4:
190065258-190065258
CTintergenicDe novo--Yuen2016 G
Yuen2017 G
LINC01060     AU2437302chr4:
189796389-189796389
GTintergenicDe novo--Yuen2017 G
LINC01060     1-0339-004chr4:
190283499-190283503
TCAAATintergenicDe novo--Yuen2017 G
LINC01060     AU2437302chr4:
190001942-190001942
CAintergenicDe novo--Yuen2017 G
LINC01060     AU2035301chr4:
190122847-190122847
AGintergenicDe novo--Yuen2017 G
LINC01060     AU2035301chr4:
190126032-190126032
GCintergenicDe novo--Yuen2017 G
LINC01060     2-0299-003chr4:
189386380-189386380
GAncRNA_intronicDe novo--Yuen2017 G
LINC01060     2-1269-003chr4:
189845505-189845505
GAintergenicDe novo--Yuen2016 G
Yuen2017 G
LINC01060     2-1352-003chr4:
190562988-190562988
CAintergenicDe novo--Yuen2017 G
LINC01060     2-0135-003chr4:
189475992-189475992
TGncRNA_intronicDe novo--Yuen2017 G
LINC01060     AU4089302chr4:
190531627-190531627
CTintergenicDe novo--Yuen2017 G
LINC01060     1-0597-003chr4:
190137443-190137443
TAintergenicDe novo--Yuen2017 G
LINC01060     2-1635-004chr4:
189602616-189602616
CTintergenicDe novo--Yuen2017 G
LINC01060     AU2988302chr4:
189431665-189431667
TAATAAAAncRNA_intronicDe novo--Yuen2017 G
LINC01060     1-0804-003chr4:
189417153-189417153
GCncRNA_intronicDe novo--Yuen2017 G
LINC01060     AU2248302chr4:
189802524-189802524
CGintergenicDe novo--Yuen2017 G
LINC01060     1-0271-004chr4:
190296486-190296486
CTintergenicDe novo--Yuen2017 G
LINC01060     AU4483301chr4:
190129175-190129175
GAintergenicDe novo--Yuen2017 G
LINC01060     2-1407-003chr4:
189553529-189553534
AGGGGGAGGGGGGintergenicDe novo--Yuen2017 G
LINC01060     2-1429-004chr4:
189929583-189929583
TCintergenicDe novo--Yuen2017 G
LINC01060     1-0458-004chr4:
189803457-189803459
CTTCintergenicDe novo--Yuen2017 G
LINC01060     2-0208-004chr4:
189627534-189627534
TAintergenicDe novo--Yuen2017 G
LINC01060     2-1567-004chr4:
190221132-190221132
CTintergenicDe novo--Yuen2017 G
LINC01060     2-1620-004chr4:
189636543-189636543
CAintergenicDe novo--Yuen2017 G
LINC01060     1-0566-003chr4:
190051616-190051616
CAintergenicDe novo--Yuen2017 G
LINC01060     AU3858303chr4:
189389396-189389396
CTncRNA_intronicDe novo--Yuen2017 G
LINC01060     5-0095-003chr4:
190130545-190130545
CTintergenicDe novo--Yuen2017 G
LINC01060     AU1404302chr4:
190028263-190028263
TCintergenicDe novo--Yuen2017 G
LINC01060     AU2029303chr4:
189495206-189495206
CTncRNA_intronicDe novo--Yuen2017 G
LINC01060     AU3646301chr4:
190434229-190434229
GTintergenicDe novo--Yuen2017 G
LINC01060     AU4015301chr4:
189910077-189910077
CTintergenicDe novo--Yuen2017 G
LINC01060     2-1358-003chr4:
190169557-190169557
CTintergenicDe novo--Yuen2017 G
LINC01060     2-1356-003chr4:
189745712-189745720
GCACACACAGCACACACACAintergenicDe novo--Yuen2017 G
LINC01060     AU2975302chr4:
190510171-190510171
AGintergenicDe novo--Yuen2017 G
LINC01060     2-0303-004chr4:
190116821-190116821
GTintergenicDe novo--Yuen2017 G
LINC01060     2-1160-003chr4:
189835016-189835016
CGintergenicDe novo--Yuen2017 G
LINC01060     1-0367-003chr4:
189664564-189664564
GAintergenicDe novo--Yuen2017 G
LINC01060     AU3801301chr4:
190204614-190204614
GCintergenicDe novo--Yuen2017 G
LINC01060     1-0354-006chr4:
189393729-189393729
CTncRNA_intronicDe novo--Yuen2017 G
LINC01060     1-0436-003chr4:
190463703-190463703
GAintergenicDe novo--Yuen2016 G
Yuen2017 G
LINC01060     2-0208-003chr4:
189627534-189627534
TAintergenicDe novo--Yuen2017 G
LINC01060     AU4067303chr4:
190123712-190123712
TCintergenicDe novo--Yuen2017 G
LINC01060     2-0142-003chr4:
189571486-189571486
TAintergenicDe novo--Yuen2017 G
LINC01060     2-0019-004chr4:
189654402-189654402
CCAGGATintergenicDe novo--Yuen2017 G
LINC01060     AU4426303chr4:
190159495-190159495
ACintergenicDe novo--Yuen2017 G
LINC01060     AU4243302chr4:
190517001-190517007
CAGAGAGCAGintergenicDe novo--Yuen2017 G
LINC01060     1-0973-003chr4:
190274477-190274477
CTintergenicDe novo--Yuen2017 G
LINC01060     5-0015-004chr4:
189729608-189729608
TCintergenicDe novo--Yuen2017 G
LINC01060     1-0554-003chr4:
189884008-189884008
AGintergenicDe novo--Yuen2017 G
LINC01060     1-0986-003chr4:
190395153-190395153
AGintergenicDe novo-6.836E-5Yuen2017 G
LINC01060     2-1283-004chr4:
189524888-189524888
TCintergenicDe novo--Yuen2017 G
LINC01060     AU4237304chr4:
190320486-190320486
GCintergenicDe novo--Yuen2017 G
LINC01060     2-0295-004chr4:
190408489-190408489
CTintergenicDe novo--Yuen2017 G
LINC01060     2-1269-003chr4:
190565087-190565090
TGGGTGGintergenicDe novo--Yuen2017 G
LINC01060     AU3057302chr4:
189536722-189536722
GAintergenicDe novo--Yuen2017 G
LINC01060     5-0046-003chr4:
189428366-189428366
GAncRNA_intronicDe novo--Yuen2017 G
LINC01060     AU2029302chr4:
189495206-189495206
CTncRNA_intronicDe novo--Yuen2017 G
LINC01060     1-0674-003chr4:
189560451-189560451
GAintergenicDe novo--Yuen2017 G
LINC01060     2-0129-005chr4:
189643408-189643408
GAintergenicDe novo--Yuen2017 G
LINC01060     AU1987304chr4:
190049804-190049804
GAintergenicDe novo--Yuen2017 G
LINC01060     A1chr4:
190422314-190422314
CTintergenicDe novo--Wu2018 G
LINC01060     AU2022302chr4:
189920395-189920395
GTintergenicDe novo--Yuen2017 G
LINC01060     1-0972-003chr4:
189896945-189896957
AGTTGTTGTTGTTAGTTGTTGTTintergenicDe novo--Yuen2017 G
LINC01060     7-0250-003chr4:
189605309-189605309
CTintergenicDe novo--Yuen2017 G
LINC01060     1-0346-004chr4:
189727503-189727503
TAintergenicDe novo--Yuen2017 G
LINC01060     AU3861301chr4:
190561899-190561899
AGintergenicDe novo--Yuen2017 G
LINC01060     1-0079-008chr4:
189842838-189842838
TCintergenicDe novo--Yuen2017 G
LINC01060     AU031404chr4:
189954429-189954429
GCintergenicDe novo--Yuen2017 G
LINC01060     1-0414-005chr4:
190237556-190237558
ACTAintergenicDe novo--Yuen2017 G
LINC01060     3-0431-000chr4:
189458918-189458918
TCncRNA_intronicDe novo--Yuen2016 G
Yuen2017 G
LINC01060     1-0755-003chr4:
190492035-190492035
AGintergenicDe novo--Yuen2017 G
LINC01060     2-1258-003chr4:
190202397-190202397
AGintergenicDe novo--Yuen2017 G
LINC01060     7-0140-003chr4:
190425257-190425257
TCintergenicDe novo--Yuen2017 G
LINC01060     2-1283-003chr4:
189524888-189524888
TCintergenicDe novo--Yuen2017 G
LINC01060     2-0305-003chr4:
189533025-189533025
GAintergenicDe novo--Yuen2017 G
LINC01060     2-1153-003chr4:
189771204-189771204
GAintergenicDe novo--Yuen2016 G
Yuen2017 G
LINC01060     3-0430-000chr4:
190503467-190503467
TAintergenicDe novo--Yuen2016 G
LINC01060     2-1605-003chr4:
190291737-190291737
CCCGGAGTCATTTTCACGCAGTCATintergenicDe novo--Yuen2017 G
LINC01060     2-1646-003chr4:
190327911-190327911
CTintergenicDe novo--Yuen2017 G
LINC01060     AU2035302chr4:
190122847-190122847
AGintergenicDe novo--Yuen2017 G
LINC01060     AU2035302chr4:
190126032-190126032
GCintergenicDe novo--Yuen2017 G
LINC01060     11456.p1chr4:
190093622-190093622
GAintergenicDe novo--Turner2016 G
LINC01060     11252.p1chr4:
190288151-190288151
AGintergenicDe novo--Turner2016 G
LINC01060     7-0223-003chr4:
189654777-189654777
GCintergenicDe novo--Yuen2017 G
LINC01060     2-0297-004chr4:
190502022-190502022
GAintergenicDe novo--Yuen2017 G
LINC01060     7-0102-003chr4:
190322817-190322817
AGintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More