or
or
Exact

Results for "NMNAT3"

Variant Events: 21

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
NMNAT3     SSC08243chr3:
139280174-139280174
TCexonicDe novononsynonymous SNVNM_001200047
NM_178177
c.A170G
c.A326G
p.N57S
p.N109S
13.51-Lim2017 E
NMNAT3     14642.p1chr3:
139620138-139620138
CTintergenicDe novo--Turner2016 G
NMNAT3     1-0141-003chr3:
139578003-139578003
CGintergenicDe novo--Yuen2017 G
NMNAT3     1-0488-003chr3:
139636411-139636411
TCintergenicDe novo--Yuen2017 G
NMNAT3     AU4235303chr3:
139332666-139332666
TGintronicDe novo--Yuen2017 G
NMNAT3     AU4356302chr3:
139509002-139509002
AGintergenicDe novo--Yuen2017 G
NMNAT3     AU2165301chr3:
139363768-139363768
GAintronicDe novo--Yuen2017 G
NMNAT3     1-0051-005chr3:
139544921-139544921
GTintergenicDe novo--Yuen2017 G
NMNAT3     2-0043-003chr3:
139523120-139523120
GTintergenicDe novo--Yuen2016 G
Yuen2017 G
NMNAT3     2-1442-003chr3:
139542111-139542111
GAintergenicDe novo--Yuen2016 G
Yuen2017 G
NMNAT3     1-0512-003chr3:
139606204-139606205
ACAintergenicDe novo--Yuen2017 G
NMNAT3     AU4423303chr3:
139565322-139565322
TCintergenicDe novo--Yuen2017 G
NMNAT3     2-0132-004chr3:
139316323-139316323
AGintronicDe novo--Yuen2017 G
NMNAT3     AU2123302chr3:
139455643-139455655
TAAGGCTGTTGAATAAGGCTGTTGAAAAGGCTGTTGAAintergenicDe novo--Yuen2017 G
NMNAT3     13555.p1chr3:
139280174-139280174
TCexonicDe novononsynonymous SNVNM_001200047
NM_178177
c.A170G
c.A326G
p.N57S
p.N109S
13.51-Ji2016 E
Krumm2015 E
Satterstrom2020 E
NMNAT3     AU3302302chr3:
139493298-139493298
TGintergenicDe novo--Yuen2017 G
NMNAT3     2-1629-003chr3:
139433302-139433302
AGintergenicDe novo--Yuen2017 G
NMNAT3     1-0514-003chr3:
139368046-139368046
CTintronicDe novo--Yuen2016 G
Yuen2017 G
NMNAT3     3-0134-000chr3:
139620057-139620059
CCACintergenicDe novo--Yuen2017 G
NMNAT3     5-0014-004chr3:
139316578-139316578
GAintronicDe novo--Yuen2017 G
NMNAT3     AU070703chr3:
139496929-139496929
CTintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More