or
or
Exact

Results for "EYS"

Variant Events: 128

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
EYS     2-1334-003chr6:
64672173-64672173
GAintronicDe novo--Yuen2016 G
Yuen2017 G
EYS     1-0006-004chr6:
66149312-66149312
GAintronicDe novo--Yuen2017 G
EYS     3-0456-000chr6:
65926693-65926702
ATATATTATAATATAintronicDe novo--Yuen2017 G
EYS     AU3712302chr6:
66445067-66445067
TCintergenicDe novo--Yuen2017 G
EYS     2-1521-003chr6:
64723150-64723150
CTintronicDe novo--Yuen2017 G
EYS     7-0273-003chr6:
65116713-65116713
AGintronicDe novo--Yuen2017 G
EYS     1-0259-003chr6:
65739172-65739172
AAAGAGTTintronicDe novo--Yuen2017 G
EYS     2-0142-004chr6:
65759428-65759428
TCintronicDe novo--Yuen2017 G
EYS     AU024607chr6:
66342932-66342932
TCintronicDe novo--Yuen2017 G
EYS     AU072004chr6:
64977549-64977549
TGintronicDe novo--Yuen2017 G
EYS     2-0223-004chr6:
64948981-64948981
TGintronicDe novo--Yuen2017 G
EYS     7-0135-003chr6:
65042644-65042649
CACAACCACintronicDe novo--Yuen2017 G
EYS     2-0240-004chr6:
66446989-66446989
AGintergenicDe novo--Yuen2017 G
EYS     AU3399303chr6:
65636535-65636535
TCintronicDe novo--Yuen2017 G
EYS     13096.p1chr6:
65146093-65146093
GAexonicDe novosynonymous SNVNM_001142800
NM_001292009
c.C5901T
c.C5901T
p.N1967N
p.N1967N
--Iossifov2012 E
Iossifov2014 E
Kosmicki2017 E
Krupp2017 E
Satterstrom2020 E
EYS     1-0522-003chr6:
65950286-65950286
CTintronicDe novo--Yuen2017 G
EYS     AU030703chr6:
65742679-65742679
GTintronicDe novo--Yuen2017 G
EYS     AU2458303chr6:
65838231-65838231
GAintronicDe novo--Yuen2017 G
EYS     AU4024303chr6:
66481049-66481049
CTintergenicDe novo--Yuen2017 G
EYS     1-0965-003chr6:
66087761-66087761
CTintronicDe novo--Yuen2017 G
EYS     AU034904chr6:
65548839-65548839
TCintronicDe novo--Yuen2017 G
EYS     AU2293302chr6:
65653053-65653053
CTintronicDe novo--Yuen2017 G
EYS     2-0198-005chr6:
64632185-64632185
GTintronicDe novo--Yuen2017 G
EYS     2-0198-005chr6:
64628103-64628103
CGintronicDe novo--Yuen2017 G
EYS     2-0256-004chr6:
66458262-66458272
CATATTCATAACintergenicDe novo--Yuen2017 G
EYS     2-0309-004chr6:
65232960-65232960
CTintronicDe novo--Yuen2017 G
EYS     7-0248-003chr6:
65189597-65189597
TAintronicDe novo--Yuen2017 G
EYS     AU2569303chr6:
64652466-64652466
AGintronicDe novo--Yuen2017 G
EYS     AU3605303chr6:
65540568-65540568
GTintronicDe novo--Yuen2017 G
EYS     AU024104chr6:
65713126-65713126
GCintronicDe novo--Yuen2017 G
EYS     AU3881302chr6:
64886325-64886325
TAintronicDe novo--Yuen2017 G
EYS     5-0105-003chr6:
65826461-65826461
ACintronicDe novo--Yuen2017 G
EYS     2-1436-003chr6:
65677179-65677179
CTintronicDe novo--Yuen2017 G
EYS     1-0547-003chr6:
65170311-65170314
CAAACAAintronicDe novo--Yuen2017 G
EYS     2-0045-003chr6:
64634412-64634412
AGintronicDe novo--Yuen2016 G
Yuen2017 G
EYS     AU3918301chr6:
64487319-64487319
GCintronicDe novo--Yuen2017 G
EYS     1-0186-005chr6:
65105663-65105663
ACintronicDe novo--Yuen2017 G
EYS     1-0203-003chr6:
65753034-65753034
TAintronicDe novo--Yuen2017 G
EYS     AU2292301chr6:
66079808-66079808
TCintronicDe novo--Yuen2017 G
EYS     1-0043-003chr6:
65704066-65704066
GAintronicDe novo--Yuen2017 G
EYS     2-1617-003chr6:
64457033-64457033
GTintronicDe novo--Yuen2017 G
EYS     3-0456-000Bchr6:
65926693-65926702
ATATATTATAATATAintronicDe novo--Yuen2017 G
EYS     7-0077-003chr6:
66270294-66270297
CATACAintronicDe novo--Yuen2017 G
EYS     AU4260303chr6:
65196476-65196476
CTintronicDe novo--Yuen2017 G
EYS     AU046703chr6:
64752413-64752413
GAintronicDe novo--Yuen2017 G
EYS     AU3645301chr6:
66435111-66435111
AGintergenicDe novo--Yuen2017 G
EYS     AU3692301chr6:
66235529-66235529
CTintronicDe novo--Yuen2017 G
EYS     AU3846302chr6:
66153047-66153047
AGintronicDe novo--Yuen2017 G
EYS     AU3768302chr6:
64731401-64731401
CTintronicDe novo--Yuen2017 G
EYS     1-0972-003chr6:
64989418-64989418
CGintronicDe novo--Yuen2017 G
EYS     AU3605304chr6:
65589440-65589440
GAintronicDe novo--Yuen2017 G
EYS     3-0065-000chr6:
64556062-64556062
TCintronicDe novo--Yuen2017 G
EYS     1-0051-004chr6:
66333134-66333134
TCintronicDe novo--Yuen2017 G
EYS     2-0057-004chr6:
66451280-66451280
TGintergenicDe novo--Yuen2017 G
EYS     1-0051-004chr6:
64620060-64620060
CTintronicDe novo--Yuen2017 G
EYS     AU4462302chr6:
64455122-64455122
CGintronicDe novo--Yuen2017 G
EYS     7-0148-003chr6:
65074724-65074724
AGintronicDe novo--Yuen2017 G
EYS     AU4006302chr6:
64512481-64512481
CAintronicDe novo--Yuen2017 G
EYS     1-0028-003chr6:
65217870-65217870
GCintronicDe novo--Yuen2017 G
EYS     AU050403chr6:
66448881-66448881
CTintergenicDe novo--Yuen2017 G
EYS     2-1005-003chr6:
66081410-66081410
ACintronicDe novo--Yuen2017 G
EYS     A23chr6:
65634432-65634432
TCintronicDe novo--Wu2018 G
EYS     1-0184-003chr6:
66334012-66334012
TCintronicDe novo--Yuen2017 G
EYS     AU2075302chr6:
64727292-64727292
CAintronicDe novo--Yuen2017 G
EYS     AU027506chr6:
65919079-65919079
ACintronicDe novo--Yuen2017 G
EYS     AU2292302chr6:
66079808-66079808
TCintronicDe novo--Yuen2017 G
EYS     A2chr6:
66301982-66301982
CTintronicDe novo--Wu2018 G
EYS     SP0001470chr6:
64488058-64488058
ATexonicDe novononsynonymous SNVNM_001142800
NM_001292009
c.T7739A
c.T7739A
p.L2580H
p.L2580H
11.34-Feliciano2019 E
EYS     AU2525302chr6:
66162008-66162008
AGintronicDe novo--Yuen2017 G
EYS     2-1451-003chr6:
64787638-64787638
GAintronicDe novo--Yuen2017 G
EYS     AU3874301chr6:
65375587-65375587
CGintronicDe novo--Yuen2017 G
EYS     AU2000304chr6:
65874023-65874023
TCintronicDe novo--Yuen2017 G
EYS     1-0804-003chr6:
65748193-65748200
ATTTTTTTATTTTTTTTintronicDe novo--Yuen2017 G
EYS     2-1561-003chr6:
66103632-66103632
CTintronicDe novo--Yuen2017 G
EYS     AU4072303chr6:
66003786-66003786
TCintronicDe novo--Yuen2017 G
EYS     1-0539-003chr6:
64646089-64646089
CTintronicDe novo--Yuen2017 G
EYS     1-0271-004chr6:
64680920-64680920
CAintronicDe novo--Yuen2017 G
EYS     2-0145-004chr6:
65768338-65768338
CGintronicDe novo--Yuen2017 G
EYS     3-0246-000chr6:
65016433-65016433
GCintronicDe novo--Yuen2016 G
EYS     1-0323-004chr6:
65241726-65241726
TTGTAAintronicDe novo--Yuen2017 G
EYS     A2chr6:
64859267-64859267
CTintronicDe novo--Wu2018 G
EYS     2-1366-003chr6:
64503985-64503985
CTintronicDe novo--Yuen2017 G
EYS     1-0566-003chr6:
64503084-64503084
CTintronicDe novo--Yuen2017 G
EYS     AU4233301chr6:
65769131-65769131
TCintronicDe novo--Yuen2017 G
EYS     AU3790301chr6:
64760126-64760126
TGintronicDe novo--Yuen2017 G
EYS     2-1455-003chr6:
65641812-65641812
GAintronicDe novo--Yuen2016 G
EYS     2-0286-004chr6:
64449826-64449826
CTintronicDe novo--Yuen2017 G
EYS     2-1146-003chr6:
65132011-65132023
CAGATAGATAGATCAGATAGATintronicDe novo--Yuen2017 G
EYS     AU057404chr6:
65321650-65321650
AGintronicDe novo--Yuen2017 G
EYS     AU3646301chr6:
65448541-65448541
CGintronicDe novo--Yuen2017 G
EYS     2-1398-003chr6:
65266360-65266360
GAintronicDe novo--Yuen2017 G
EYS     AU2100302chr6:
65297214-65297214
TCintronicDe novo--Yuen2017 G
EYS     14590.p1chr6:
64705617-64705617
CTintronicDe novo--Turner2016 G
EYS     2-0070-004chr6:
65544625-65544625
CTintronicDe novo--Yuen2017 G
EYS     12449.p1chr6:
65895372-65895372
TCintronicDe novo--Turner2016 G
EYS     14637.p1chr6:
66163992-66163992
CTintronicDe novo--Turner2016 G
EYS     13171.p1chr6:
66180206-66180206
TAintronicDe novo--Turner2016 G
EYS     AU1308303chr6:
65033812-65033812
ACintronicDe novo--Yuen2017 G
EYS     AU3801301chr6:
66394825-66394829
CCTCTCCTintronicDe novo--Yuen2017 G
EYS     2-0198-004chr6:
64632185-64632185
GTintronicDe novo--Yuen2017 G
EYS     2-1085-004chr6:
66409994-66409994
CTintronicDe novo--Yuen2017 G
EYS     2-1132-003chr6:
65673767-65673767
TCintronicDe novo--Yuen2017 G
EYS     3-0080-000chr6:
66256825-66256825
GAintronicDe novo--Yuen2016 G
Yuen2017 G
EYS     2-0198-004chr6:
64628103-64628103
CGintronicDe novo--Yuen2017 G
EYS     AU4012302chr6:
66074733-66074733
ATintronicDe novo--Yuen2017 G
EYS     2-1567-003chr6:
65589545-65589545
TCintronicDe novo--Yuen2017 G
EYS     AU2000305chr6:
64762897-64762897
TCintronicDe novo--Yuen2017 G
EYS     AU2787302chr6:
64983830-64983830
AGintronicDe novo--Yuen2017 G
EYS     AU4237301chr6:
64558058-64558058
GAintronicDe novo--Yuen2017 G
EYS     2-0238-004chr6:
65354019-65354019
CTintronicDe novo--Yuen2017 G
EYS     2-1427-003chr6:
64443822-64443822
AGintronicDe novo--Yuen2017 G
EYS     AU3839303chr6:
66487885-66487885
CTintergenicDe novo--Yuen2017 G
EYS     1-0555-003chr6:
66388833-66388833
CTintronicDe novo--Yuen2017 G
EYS     AU3858302chr6:
66187214-66187214
TCintronicDe novo--Yuen2017 G
EYS     2-0295-004chr6:
66201018-66201018
AGintronicDe novo--Yuen2017 G
EYS     5-0129-003chr6:
65537207-65537207
TGintronicDe novo--Yuen2017 G
EYS     AU3190305chr6:
66310822-66310822
ACintronicDe novo--Yuen2017 G
EYS     AU2089301chr6:
64541702-64541702
TGintronicDe novo--Yuen2017 G
EYS     SSC07063chr6:
65146093-65146093
GAexonicDe novosynonymous SNVNM_001142800
NM_001292009
c.C5901T
c.C5901T
p.N1967N
p.N1967N
--Lim2017 E
EYS     5-0077-003chr6:
64599341-64599341
AAAGintronicDe novo--Yuen2017 G
EYS     AU1894304chr6:
64822062-64822062
AGintronicDe novo--Yuen2017 G
EYS     1-0389-003chr6:
66205041-66205041
AGexonicDe novononsynonymous SNVNM_198283
NM_001142800
NM_001142801
NM_001292009
c.T263C
c.T263C
c.T263C
c.T263C
p.L88P
p.L88P
p.L88P
p.L88P
13.45-Yuen2015 G
EYS     AU2089301chr6:
64541680-64541680
TCintronicDe novo--Yuen2017 G
EYS     AU4056302chr6:
64763907-64763911
CTATACTAintronicDe novo--Yuen2017 G
EYS     2-1205-003chr6:
66198165-66198165
TCintronicDe novo--Yuen2016 G
Yuen2017 G
EYS     AU4159302chr6:
65152258-65152258
AGintronicDe novo--Yuen2017 G
EYS     AU4314302chr6:
65046340-65046340
CTintronicDe novo--Yuen2017 G
EYS     AU1995302chr6:
65515575-65515575
GTintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More