or
or
Exact

Results for "LINC01139"

Variant Events: 72

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
LINC01139     1-0403-004chr1:
239536585-239536585
TAintergenicDe novo--Yuen2017 G
LINC01139     2-1306-004chr1:
238757084-238757084
TCintergenicDe novo--Yuen2017 G
LINC01139     1-0481-003chr1:
238838138-238838138
GGTGGTTintergenicDe novo--Yuen2017 G
LINC01139     2-1620-004chr1:
238862245-238862245
GCintergenicDe novo--Yuen2017 G
LINC01139     AU025704chr1:
239505900-239505900
GCintergenicDe novo--Yuen2017 G
LINC01139     13143.p1chr1:
239763335-239763338
CCTTCintergenicDe novo--Wilfert2021 G
LINC01139     AU1355301chr1:
239216906-239216906
GAintergenicDe novo--Yuen2017 G
LINC01139     1-0436-003chr1:
239130146-239130146
CGintergenicDe novo--Yuen2016 G
Yuen2017 G
LINC01139     AU2863302chr1:
239083525-239083525
ATintergenicDe novo--Yuen2017 G
LINC01139     5-0014-003chr1:
238733404-238733404
TAintergenicDe novo--Yuen2017 G
LINC01139     AU3397302chr1:
239709056-239709063
ATTTTTTTATTTTTTintergenicDe novo--Yuen2017 G
LINC01139     2-0286-004chr1:
238981652-238981655
TTTCTintergenicDe novo--Yuen2017 G
LINC01139     AU4444304chr1:
239068364-239068364
AGintergenicDe novo--Yuen2017 G
LINC01139     AU1223301chr1:
239085234-239085238
CTTTTCTTTintergenicDe novo--Yuen2017 G
LINC01139     AU2075301chr1:
239462510-239462521
TACACACACACATACACACACAintergenicDe novo--Yuen2017 G
LINC01139     1-0381-003chr1:
238847968-238847968
CTintergenicDe novo--Yuen2017 G
LINC01139     2-1292-004chr1:
239703662-239703662
TCintergenicDe novo--Yuen2017 G
LINC01139     2-1425-003chr1:
239271859-239271859
ATintergenicDe novo--Yuen2017 G
LINC01139     AU2793303chr1:
239604634-239604634
TCintergenicDe novo--Yuen2017 G
LINC01139     1-0067-004chr1:
239278763-239278763
GAintergenicDe novo--Yuen2017 G
LINC01139     2-1306-003chr1:
238757084-238757084
TCintergenicDe novo--Yuen2017 G
LINC01139     1-0627-006chr1:
238814536-238814536
TCintergenicDe novo--Yuen2017 G
LINC01139     AU3913303chr1:
238784554-238784554
GTintergenicDe novo--Yuen2017 G
LINC01139     1-0652-004chr1:
239573741-239573741
TCintergenicDe novo--Yuen2017 G
LINC01139     1-0490-003chr1:
239008028-239008028
TCintergenicDe novo--Yuen2017 G
LINC01139     2-1183-003chr1:
238742485-238742485
TCintergenicDe novo--Yuen2017 G
LINC01139     AU2000305chr1:
239079969-239079969
GAintergenicDe novo--Yuen2017 G
LINC01139     2-0223-003chr1:
238673255-238673255
TTATCintergenicDe novo--Yuen2017 G
LINC01139     1-0446-003chr1:
239578963-239578967
TAATATintergenicDe novo--Yuen2017 G
LINC01139     A20chr1:
238993596-238993596
CTintergenicDe novo--Wu2018 G
LINC01139     AU056804chr1:
239238110-239238110
TCintergenicDe novo--Yuen2017 G
LINC01139     AU4164301chr1:
239097297-239097297
AGintergenicDe novo--Yuen2017 G
LINC01139     2-0305-004chr1:
238995947-238995947
GTintergenicDe novo--Yuen2017 G
LINC01139     7-0055-003chr1:
239436960-239436960
GAintergenicDe novo--Yuen2017 G
LINC01139     1-0175-004chr1:
238703167-238703167
GTintergenicDe novo--Yuen2017 G
LINC01139     2-1313-003chr1:
238991574-238991574
CTintergenicDe novo--Yuen2016 G
Yuen2017 G
LINC01139     2-1266-003chr1:
238878800-238878800
GAintergenicDe novo--Yuen2016 G
Yuen2017 G
LINC01139     AU3586303chr1:
238883037-238883037
ATintergenicDe novo--Yuen2017 G
LINC01139     2-1292-003chr1:
239271863-239271863
CTintergenicDe novo--Yuen2017 G
LINC01139     1-0487-003chr1:
239180341-239180341
CGintergenicDe novo--Yuen2016 G
Yuen2017 G
LINC01139     AU3721302chr1:
238990660-238990660
CGintergenicDe novo--Yuen2017 G
LINC01139     2-1105-003chr1:
239554979-239554979
GTintergenicDe novo--Yuen2016 G
Yuen2017 G
LINC01139     2-1305-003chr1:
238823300-238823300
TCintergenicDe novo--Yuen2016 G
Yuen2017 G
LINC01139     AU3891303chr1:
239170354-239170354
GAintergenicDe novo--Yuen2017 G
LINC01139     2-0028-003chr1:
239408706-239408706
TAintergenicDe novo--Yuen2016 G
Yuen2017 G
LINC01139     2-1085-003chr1:
239128209-239128209
CTintergenicDe novo--Yuen2017 G
LINC01139     3-0661-000chr1:
239138083-239138085
ATTATTTintergenicDe novo--Yuen2017 G
LINC01139     AU4056301chr1:
238762544-238762544
TAintergenicDe novo--Yuen2017 G
LINC01139     1-0041-003chr1:
239092174-239092174
TCintergenicDe novo--Yuen2016 G
Yuen2017 G
LINC01139     AU054103chr1:
239028186-239028186
CGintergenicDe novo--Yuen2017 G
LINC01139     AU4176302chr1:
239425798-239425798
CAintergenicDe novo--Yuen2017 G
LINC01139     1-0019-004chr1:
239270351-239270351
AGintergenicDe novo--Yuen2017 G
LINC01139     1-0175-003chr1:
238703167-238703167
GTintergenicDe novo--Yuen2017 G
LINC01139     AU3937301chr1:
239078120-239078120
GCintergenicDe novo--Yuen2017 G
LINC01139     3-0456-000chr1:
239567740-239567743
AAGAAAintergenicDe novo--Yuen2017 G
LINC01139     3-0111-000chr1:
239609118-239609118
ACintergenicDe novo--Yuen2016 G
LINC01139     2-1176-003chr1:
239084880-239084880
GAintergenicDe novo--Yuen2017 G
LINC01139     1-0965-003chr1:
238711815-238711815
CTintergenicDe novo--Yuen2017 G
LINC01139     7-0249-004chr1:
239736517-239736517
CAintergenicDe novo--Yuen2017 G
LINC01139     AU2075302chr1:
239462510-239462521
TACACACACACATACACACACAintergenicDe novo--Yuen2017 G
LINC01139     2-1510-003chr1:
238684718-238684733
TTATATATATATATATTTATATATATATATintergenicDe novo--Yuen2017 G
LINC01139     AU024607chr1:
238669530-238669530
AGintergenicDe novo--Yuen2017 G
LINC01139     2-1196-003chr1:
239557888-239557888
GAintergenicDe novo--Yuen2016 G
LINC01139     AU0540301chr1:
239659435-239659442
CTTTTTTTCTTTTTTintergenicDe novo--Yuen2017 G
LINC01139     AU4264302chr1:
239018707-239018707
ACintergenicDe novo--Yuen2017 G
LINC01139     AU2950301chr1:
238672236-238672241
CTTTTTCTTTintergenicDe novo--Yuen2017 G
LINC01139     AU4027306chr1:
239399765-239399765
GCintergenicDe novo--Yuen2017 G
LINC01139     2-1093-005chr1:
238756538-238756538
GCintergenicDe novo--Yuen2017 G
LINC01139     2-1220-003chr1:
239289852-239289852
TGintergenicDe novo--Yuen2016 G
Yuen2017 G
LINC01139     AU4237302 Complex Event; expand row to view variants  De novo--Yuen2017 G
Yuen2017 G
LINC01139     2-0273-003chr1:
239398618-239398618
ACintergenicDe novo--Yuen2017 G
LINC01139     2-1339-003chr1:
239417713-239417713
TCintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More