or
or
Exact

Results for "GRM7"

Variant Events: 75

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
GRM7     AU4237302chr3:
7239411-7239413
AGGAGintronicDe novo--Yuen2017 G
GRM7     2-1188-003chr3:
7333041-7333041
TCintronicDe novo--Yuen2017 G
GRM7     1-0006-003chr3:
7417196-7417196
TGintronicDe novo--Yuen2017 G
GRM7     2-1366-004chr3:
6969394-6969394
ATintronicDe novo--Yuen2017 G
GRM7     7-0179-003chr3:
7466892-7466892
GAintronicDe novo--Yuen2017 G
GRM7     AU3649305chr3:
7905936-7905936
TCintergenicDe novo--Yuen2017 G
GRM7     AU3076302chr3:
7524321-7524321
TCintronicDe novo--Yuen2017 G
GRM7     EGAN00001101089chr3:
7620302-7620302
AGexonicDe novononsynonymous SNVNM_000844
NM_181874
c.A1709G
c.A1709G
p.N570S
p.N570S
12.644.0E-4Satterstrom2020 E
GRM7     5-0025-003chr3:
7886298-7886298
GAintergenicDe novo--Yuen2017 G
GRM7     AU4197301chr3:
7063798-7063798
GAintronicDe novo--Yuen2017 G
GRM7     1-0010-005chr3:
7131328-7131330
CATCintronicDe novo--Yuen2017 G
GRM7     2-1295-003chr3:
7897155-7897155
CTintergenicDe novo--Yuen2016 G
Yuen2017 G
GRM7     2-1460-003chr3:
7012947-7012947
GAintronicDe novo--Yuen2017 G
GRM7     AU050604chr3:
7934989-7934990
GCGCCintergenicDe novo--Yuen2017 G
GRM7     2-1358-003chr3:
7488767-7488767
GAintronicDe novo--Yuen2017 G
GRM7     2-1295-003chr3:
6988993-6988993
ATintronicDe novo--Yuen2016 G
Yuen2017 G
GRM7     AU012804chr3:
7154375-7154375
CGintronicDe novo--Yuen2017 G
GRM7     7-0248-003chr3:
7092209-7092212
GTTTGTTintronicDe novo--Yuen2017 G
GRM7     1-0067-005chr3:
7609936-7609936
TTTAintronicDe novo--Yuen2017 G
GRM7     2-1189-003chr3:
7658588-7658588
GAintronicDe novo--Yuen2016 G
Yuen2017 G
GRM7     1-0402-003chr3:
7843870-7843870
GCintergenicDe novo--Yuen2017 G
GRM7     AU4228301chr3:
7296458-7296458
CTintronicDe novo--Yuen2017 G
GRM7     AU2075301chr3:
7511523-7511523
AGintronicDe novo--Yuen2017 G
GRM7     14015.p1chr3:
7559106-7559106
GAintronicDe novo--Turner2016 G
GRM7     AU2137304chr3:
7623073-7623073
GCintronicDe novo--Yuen2017 G
GRM7     1-0067-004chr3:
7609936-7609936
TTTATATTAGACTTGATATATTATATCAAGAATTAintronicDe novo--Yuen2017 G
GRM7     5-0088-003chr3:
7351446-7351446
CTintronicDe novo--Yuen2017 G
GRM7     AU017304chr3:
7947591-7947591
ATintergenicDe novo--Yuen2017 G
GRM7     09C81990chr3:
7340438-7340438
TCexonicDe novosynonymous SNVNM_000844
NM_181874
c.T804C
c.T804C
p.D268D
p.D268D
--Satterstrom2020 E
GRM7     11470.p1chr3:
7620458-7620458
GAexonicDe novononsynonymous SNVNM_000844
NM_181874
c.G1865A
c.G1865A
p.R622Q
p.R622Q
24.58.238E-6Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Krupp2017 E
Sanders2012 E
Satterstrom2020 E
Wilfert2021 G
GRM7     1-0455-004chr3:
7116489-7116489
TCintronicDe novo--Yuen2017 G
GRM7     2-0503-004chr3:
7091337-7091337
CTintronicDe novo--Yuen2017 G
GRM7     2-1132-003chr3:
7581316-7581316
CTintronicDe novo--Yuen2017 G
GRM7     1-0332-003chr3:
7497127-7497127
CTintronicDe novo--Yuen2017 G
GRM7     1-0142-005chr3:
7599786-7599786
GGCintronicDe novo--Yuen2017 G
GRM7     2-0012-003chr3:
7619576-7619576
CAintronicDe novo--Yuen2017 G
GRM7     SSC02938chr3:
7620458-7620458
GAexonicDe novononsynonymous SNVNM_000844
NM_181874
c.G1865A
c.G1865A
p.R622Q
p.R622Q
24.58.238E-6Lim2017 E
GRM7     1-0868-003chr3:
7540523-7540523
CTintronicDe novo--Yuen2017 G
GRM7     1-0186-004chr3:
6865394-6865394
GAintergenicDe novo--Yuen2017 G
GRM7     2-1140-003chr3:
7340438-7340438
TCexonicDe novosynonymous SNVNM_000844
NM_181874
c.T804C
c.T804C
p.D268D
p.D268D
--Yuen2017 G
GRM7     AU076705chr3:
7618529-7618529
GAintronicDe novo--Yuen2017 G
GRM7     AU4234303chr3:
6868461-6868461
GAintergenicDe novo--Yuen2017 G
GRM7     AU4234303chr3:
6868466-6868466
CAintergenicDe novo--Yuen2017 G
GRM7     1-0158-012chr3:
7715519-7715525
ACATGTTAintronicDe novo--Yuen2017 G
GRM7     7-0130-003chr3:
7599786-7599786
GGCintronicDe novo--Yuen2017 G
GRM7     AU3889305chr3:
7147598-7147607
ACTTTCTTTCACTTTCintronicDe novo--Yuen2017 G
GRM7     7-0127-003chr3:
7698172-7698172
GGACTCintronicDe novo--Yuen2017 G
GRM7     1-0292-005chr3:
7735435-7735435
TCintronicDe novo--Yuen2017 G
GRM7     1-0744-003chr3:
7195205-7195205
AGintronicDe novo--Yuen2017 G
GRM7     1-0985-003chr3:
7174235-7174235
GAintronicDe novo--Yuen2017 G
GRM7     2-0503-003chr3:
7091337-7091337
CTintronicDe novo--Yuen2017 G
GRM7     2-1497-003chr3:
7054417-7054417
TAintronicDe novo--Yuen2017 G
GRM7     1-0826-004chr3:
7586696-7586696
AGintronicDe novo--Yuen2017 G
GRM7     1-0219-003chr3:
7365306-7365306
ATintronicDe novo--Yuen2017 G
GRM7     2-1715-003chr3:
7614334-7614334
AGintronicDe novo--Yuen2017 G
GRM7     1-1000-003chr3:
7132370-7132370
TAintronicDe novo--Yuen2017 G
GRM7     1-0772-003chr3:
7473689-7473689
ATintronicDe novo--Yuen2017 G
GRM7     5-0087-003chr3:
7141550-7141550
TCintronicDe novo--Yuen2017 G
GRM7     1-0459-004chr3:
7599786-7599786
GGCintronicDe novo--Yuen2017 G
GRM7     1-0414-005chr3:
7614334-7614334
AGintronicDe novo--Yuen2017 G
GRM7     1-0278-003chr3:
7465092-7465092
TCintronicDe novo--Yuen2016 G
GRM7     1-0269-003chr3:
7899864-7899865
ATAintergenicDe novo--Yuen2017 G
GRM7     2-0305-003chr3:
7226749-7226749
GAintronicDe novo--Yuen2017 G
GRM7     AU058104chr3:
6914152-6914152
GAintronicDe novo--Yuen2017 G
GRM7     2-1153-003chr3:
7719766-7719766
GCintronicDe novo--Yuen2016 G
Yuen2017 G
GRM7     1-0509-003chr3:
7937943-7937943
ACintergenicDe novo--Yuen2016 G
Yuen2017 G
GRM7     AU073006chr3:
6897513-6897513
TCintergenicDe novo--Yuen2017 G
GRM7     AU3638302chr3:
7982470-7982470
TCintergenicDe novo--Yuen2017 G
GRM7     2-0319-003chr3:
7733418-7733418
GAintronicDe novo--Yuen2017 G
GRM7     2-1336-003chr3:
7060405-7060405
ATintronicDe novo--Yuen2017 G
GRM7     2-0135-003chr3:
7240320-7240320
TGintronicDe novo--Yuen2017 G
GRM7     2-1277-003chr3:
7810951-7810951
CTintergenicDe novo--Yuen2017 G
GRM7     1-0661-003chr3:
7148276-7148276
CAintronicDe novo--Yuen2017 G
GRM7     1-0863-003chr3:
7881392-7881397
TAACAATAAintergenicDe novo--Yuen2017 G
GRM7     7-0151-003chr3:
7776931-7776931
GAintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More