or
or
Exact

Results for "GRID2"

Variant Events: 96

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
GRID2     1-0358-003chr4:
94319316-94319316
GAintronicDe novo--Yuen2017 G
GRID2     AU1933301chr4:
94063740-94063740
TCintronicDe novo--Yuen2017 G
GRID2     AU2129301chr4:
93606282-93606282
ACintronicDe novo--Yuen2017 G
GRID2     AU2035301chr4:
93617987-93617987
GTintronicDe novo--Yuen2017 G
GRID2     1-0513-003chr4:
94039657-94039657
GAintronicDe novo--Yuen2016 G
Yuen2017 G
GRID2     2-1425-004chr4:
94244992-94244992
CGintronicDe novo--Yuen2017 G
GRID2     AU056803chr4:
93248703-93248703
AGintronicDe novo--Yuen2017 G
GRID2     AU2019302chr4:
94551684-94551685
TATintronicDe novo--Yuen2017 G
GRID2     14153.p1chr4:
94640324-94640324
ATintronicDe novo--Turner2016 G
GRID2     11341.p1chr4:
94704797-94704797
GAintergenicDe novo--Turner2016 G
GRID2     11194.p1chr4:
93639668-93639668
AGintronicDe novo--Turner2016 G
GRID2     AU011021chr4:
93322058-93322068
TATCTACTGAATATCTACTGAATCTACTGAAintronicDe novo--Yuen2017 G
GRID2     12680.p1chr4:
93999571-93999571
TCintronicDe novo--Turner2016 G
GRID2     AU3051302chr4:
94003587-94003587
TCintronicDe novo--Yuen2017 G
GRID2     2-1366-003chr4:
93815934-93815934
CGintronicDe novo--Yuen2017 G
GRID2     2-1594-003chr4:
94056953-94056953
ATintronicDe novo--Yuen2017 G
GRID2     1-0440-003chr4:
93845113-93845113
CTintronicDe novo--Yuen2017 G
GRID2     2-1502-003chr4:
93366029-93366029
GAintronicDe novo--Yuen2017 G
GRID2     1-0590-003chr4:
93571867-93571867
ACintronicDe novo--Yuen2017 G
GRID2     Schaaf2011:30chr4:
94547444-94547444
GAexonicUnknownnonsynonymous SNVNM_001286838
NM_001510
c.G1933A
c.G2218A
p.V645I
p.V740I
15.540.0011Schaaf2011 T
GRID2     1-0498-003chr4:
93691001-93691001
CAintronicDe novo--Yuen2017 G
GRID2     2-1509-003chr4:
94215612-94215626
AGTGTGTGTGTGTGTAGTGTGTGTGTGTintronicDe novo--Yuen2017 G
GRID2     Schaaf2011:29chr4:
94344049-94344049
CTexonicUnknownnonsynonymous SNVNM_001286838
NM_001510
c.C1190T
c.C1475T
p.P397L
p.P492L
31.0-Schaaf2011 T
GRID2     2-1366-003chr4:
94400685-94400685
TCintronicDe novo--Yuen2017 G
GRID2     7-0067-003chr4:
94382279-94382279
GTintronicDe novo--Yuen2017 G
GRID2     1-0494-003Achr4:
93343497-93343497
AGintronicDe novo--Yuen2017 G
GRID2     2-1721-003chr4:
94164300-94164300
TAintronicDe novo--Yuen2017 G
GRID2     1-0271-003chr4:
94012639-94012639
TAintronicDe novo--Yuen2017 G
GRID2     1-0067-005chr4:
94305420-94305420
CTintronicDe novo--Yuen2017 G
GRID2     1-0459-003chr4:
93250163-93250163
CTintronicDe novo--Yuen2017 G
GRID2     2-1239-003chr4:
94045826-94045826
GTintronicDe novo--Yuen2016 G
Yuen2017 G
GRID2     5-0125-003chr4:
93565264-93565264
GTintronicDe novo--Yuen2017 G
GRID2     AU005213chr4:
93618507-93618507
GTintronicDe novo--Yuen2017 G
GRID2     2-0022-005chr4:
94630644-94630644
GAintronicDe novo--Yuen2017 G
GRID2     2-1244-003chr4:
94429534-94429534
GCintronicDe novo--Yuen2017 G
GRID2     2-1382-003chr4:
94146108-94146108
CGintronicDe novo--Yuen2016 G
Yuen2017 G
GRID2     AU047703chr4:
94527954-94527954
GCintronicDe novo--Yuen2017 G
GRID2     AU2109302chr4:
93465632-93465632
AGintronicDe novo--Yuen2017 G
GRID2     2-1398-003chr4:
93773066-93773066
CTintronicDe novo--Yuen2017 G
GRID2     AU005213chr4:
93618045-93618045
CTintronicDe novo--Yuen2017 G
GRID2     1-0494-003chr4:
93343497-93343497
AGintronicDe novo--Yuen2017 G
GRID2     1-0381-003chr4:
94616051-94616051
GAintronicDe novo--Yuen2017 G
GRID2     3-0391-000chr4:
93740761-93740761
GTintronicDe novo--Yuen2017 G
GRID2     3-0391-000chr4:
94216266-94216266
CTintronicDe novo--Yuen2017 G
GRID2     1-0443-003chr4:
93291706-93291706
GAintronicDe novo--Yuen2016 G
GRID2     1-0065-005chr4:
94681467-94681467
TCintronicDe novo--Yuen2017 G
GRID2     1-0338-005chr4:
94153357-94153357
CTintronicDe novo--Yuen2017 G
GRID2     1-0820-003chr4:
93798815-93798815
TAintronicDe novo--Yuen2017 G
GRID2     AU2792302chr4:
93962717-93962717
GCintronicDe novo--Yuen2017 G
GRID2     AU3761302chr4:
94506158-94506158
CGintronicDe novo--Yuen2017 G
GRID2     2-0006-004chr4:
94479438-94479438
TCintronicDe novo--Yuen2017 G
GRID2     2-0019-004chr4:
93765205-93765205
TGintronicDe novo--Yuen2017 G
GRID2     AU034903chr4:
93366377-93366377
AGintronicDe novo--Yuen2017 G
GRID2     AU4168306chr4:
94188526-94188526
GAintronicDe novo--Yuen2017 G
GRID2     1-0652-004chr4:
94717038-94717038
CTintergenicDe novo--Yuen2017 G
GRID2     2-0310-003chr4:
94441526-94441526
TAintronicDe novo--Yuen2017 G
GRID2     AU2165301chr4:
93685227-93685227
CGintronicDe novo--Yuen2017 G
GRID2     1-0372-003chr4:
93970273-93970273
AGintronicDe novo--Yuen2016 G
Yuen2017 G
GRID2     7-0219-003chr4:
94269085-94269085
GCintronicDe novo--Yuen2017 G
GRID2     1-0279-004chr4:
94254924-94254924
GTintronicDe novo--Yuen2017 G
GRID2     AU3918301chr4:
94581476-94581476
ATintronicDe novo--Yuen2017 G
GRID2     AU1987301chr4:
94401843-94401843
CTintronicDe novo--Yuen2017 G
GRID2     2-1322-003chr4:
93768354-93768354
ACintronicDe novo--Yuen2017 G
GRID2     AU048206chr4:
94258897-94258897
CTintronicDe novo--Yuen2017 G
GRID2     AU072504chr4:
94481870-94481870
GTintronicDe novo--Yuen2017 G
GRID2     2-1323-003chr4:
94468814-94468814
GAintronicDe novo--Yuen2016 G
Yuen2017 G
GRID2     AU1725306chr4:
94216762-94216762
GAintronicDe novo--Yuen2017 G
GRID2     NDAR_INVDA176HXG_wes1chr4:
94377044-94377044
CGexonicDe novononsynonymous SNVNM_001286838
NM_001510
c.C1492G
c.C1777G
p.P498A
p.P593A
11.95-DeRubeis2014 E
Kosmicki2017 E
Lim2017 E
Satterstrom2020 E
GRID2     AU4315302chr4:
94065456-94065456
GTintronicDe novo--Yuen2017 G
GRID2     AU024004chr4:
94351341-94351341
AGintronicDe novo--Yuen2017 G
GRID2     1-0627-003chr4:
94305645-94305645
TCintronicDe novo--Yuen2017 G
GRID2     2-1529-003chr4:
94661259-94661259
CTintronicDe novo--Yuen2017 G
GRID2     AU2129303chr4:
93532257-93532295
ATGTGTGTGTATGTGTGTGTGTGTGCATGTGTGTGTGTGATGTGTGTGCATGTGTGTGTGTGintronicDe novo--Yuen2017 G
GRID2     1-0259-005chr4:
93473625-93473625
TCintronicDe novo--Yuen2017 G
GRID2     AU1940304chr4:
94445216-94445217
CTCTTintronicDe novo--Yuen2017 G
GRID2     2-1437-004chr4:
94565564-94565564
GAintronicDe novo--Yuen2017 G
GRID2     AU000704chr4:
93931309-93931316
TAAAAAAATAAAAAAintronicDe novo--Yuen2017 G
GRID2     1-0569-003chr4:
94288077-94288091
AATATATATATATATAATATATATATATintronicDe novo--Yuen2017 G
GRID2     1-0292-005chr4:
93810390-93810390
AGintronicDe novo--Yuen2017 G
GRID2     1-0259-005chr4:
94463182-94463182
CAintronicDe novo--Yuen2017 G
GRID2     AU3913302chr4:
93758847-93758847
TAintronicDe novo--Yuen2017 G
GRID2     1-0553-003chr4:
94523152-94523155
GTCAGintronicDe novo--Yuen2017 G
GRID2     74-0265chr4:
93564739-93564739
CTintronicDe novo--Michaelson2012 G
GRID2     2-1154-003chr4:
93233127-93233127
GAintronicDe novo--Yuen2016 G
Yuen2017 G
GRID2     1-0991-003chr4:
93648565-93648565
AGintronicDe novo--Yuen2017 G
GRID2     7-0024-005chr4:
94212253-94212253
ACintronicDe novo--Yuen2017 G
GRID2     2-1153-003chr4:
94086382-94086382
GAintronicDe novo--Yuen2016 G
Yuen2017 G
GRID2     1-0028-003chr4:
94486197-94486197
AGintronicDe novo--Yuen2017 G
GRID2     AU2075302chr4:
93528873-93528873
AGintronicDe novo--Yuen2017 G
GRID2     1-0629-003chr4:
93450425-93450443
TGAGAGAGAGAGAGAGAGATGAGAGAGAGAGAGAGAintronicDe novo--Yuen2017 G
GRID2     AU4347301chr4:
93357690-93357690
GAintronicDe novo--Yuen2017 G
GRID2     2-1148-004chr4:
93351640-93351640
CTintronicDe novo--Yuen2017 G
GRID2     1-0564-003chr4:
93889473-93889473
ATintronicDe novo--Yuen2017 G
GRID2     7-0183-003chr4:
93763230-93763230
GAintronicDe novo--Yuen2017 G
GRID2     5-0033-004chr4:
93284012-93284012
CTintronicDe novo--Yuen2017 G
GRID2     1-0206-003chr4:
93826683-93826683
TGintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More