or
or
Exact

Results for "SLCO4A1"

Variant Events: 14

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
SLCO4A1     2-0295-004chr20:
61176983-61176983
GCintergenicDe novo--Yuen2017 G
SLCO4A1     2-1431-003chr20:
61198849-61198849
GCintergenicDe novo--Yuen2016 G
Yuen2017 G
SLCO4A1     2-0043-003chr20:
61203422-61203422
CAintergenicDe novo--Yuen2016 G
Yuen2017 G
SLCO4A1     1-0246-004chr20:
61182701-61182701
GGTGACACACAAACACTTTATATGACAGACACACATCCCTCAintergenicDe novo--Yuen2017 G
SLCO4A1     1-0197-003chr20:
61327486-61327486
CGintergenicDe novo--Yuen2017 G
SLCO4A1     1-0141-003chr20:
61182221-61182221
TCintergenicDe novo--Yuen2017 G
SLCO4A1     2-1425-003chr20:
61275165-61275165
ACintronicDe novo--Yuen2017 G
SLCO4A1     1-0526-003chr20:
61182391-61182391
CAintergenicDe novo--Yuen2017 G
SLCO4A1     1-0551-004chr20:
61180622-61180622
CCATTTintergenicDe novo--Yuen2017 G
SLCO4A1     5-0103-003chr20:
61209383-61209383
TCintergenicDe novo--Yuen2017 G
SLCO4A1     12719.p1chr20:
61303111-61303111
GAexonicDe novononsynonymous SNVNM_016354c.G2035Ap.V679I0.0122.0E-4Iossifov2014 E
Kosmicki2017 E
Satterstrom2020 E
Wilfert2021 G
SLCO4A1     2-0142-004chr20:
61270572-61270572
GCintergenicDe novo--Yuen2017 G
SLCO4A1     2-0143-004chr20:
61182701-61182701
GGTGACACACAAACACTTTATATGACAGACACACATCCCTCAintergenicDe novo--Yuen2017 G
SLCO4A1     2-1620-003chr20:
61205636-61205638
AATAintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More