or
or
Exact

Results for "TENM4"

Variant Events: 95

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
TENM4     AU1725306chr11:
79904677-79904677
GAintergenicDe novo--Yuen2017 G
TENM4     AU3506303chr11:
78379540-78379540
CTintronicDe novo--Yuen2017 G
TENM4     AU3368302chr11:
78647390-78647390
CTintronicDe novo--Yuen2017 G
TENM4     1-0446-003chr11:
79689409-79689409
GTintergenicDe novo--Yuen2017 G
TENM4     AU1725306chr11:
79632007-79632007
AGintergenicDe novo--Yuen2017 G
TENM4     2-1239-003chr11:
78543482-78543482
GAintronicDe novo--Yuen2016 G
Yuen2017 G
TENM4     5-0065-003chr11:
78823121-78823121
CTintronicDe novo--Yuen2017 G
TENM4     AU4347301chr11:
79867695-79867695
TGintergenicDe novo--Yuen2017 G
TENM4     2-1239-003chr11:
78658801-78658801
GAintronicDe novo--Yuen2016 G
Yuen2017 G
TENM4     2-0057-004chr11:
78881584-78881584
GAintronicDe novo--Yuen2017 G
TENM4     2-1295-003chr11:
78373991-78373991
AGintronicDe novo--Yuen2016 G
Yuen2017 G
TENM4     2-1720-003chr11:
79791669-79791669
ATintergenicDe novo--Yuen2017 G
TENM4     2-1152-003chr11:
79611892-79611892
GTintergenicDe novo--Yuen2016 G
Yuen2017 G
TENM4     1-0045-004chr11:
80194404-80194404
CTintergenicDe novo--Yuen2017 G
TENM4     1-0436-003chr11:
80409939-80409939
GAintergenicDe novo--Yuen2016 G
Yuen2017 G
TENM4     2-1152-003chr11:
80354523-80354523
GAintergenicDe novo--Yuen2016 G
Yuen2017 G
TENM4     AU021204chr11:
78846765-78846765
CTintronicDe novo--Yuen2017 G
TENM4     AU051504chr11:
79088448-79088459
ACTCTCTCTCTCACTCTCTCTCintronicDe novo--Yuen2017 G
TENM4     AU4013302chr11:
79546802-79546802
TCintergenicDe novo--Yuen2017 G
TENM4     2-1702-003chr11:
79317454-79317454
ATintergenicDe novo--Yuen2017 G
TENM4     2-0197-004chr11:
80054822-80054822
GTintergenicDe novo--Yuen2017 G
TENM4     2-0297-004chr11:
80115900-80115900
AGintergenicDe novo--Yuen2017 G
TENM4     1-0259-003chr11:
79276852-79276852
CGintergenicDe novo--Yuen2017 G
TENM4     AU3648301chr11:
79551272-79551272
AGintergenicDe novo--Yuen2017 G
TENM4     1-0483-003chr11:
78984829-78984829
CAintronicDe novo--Yuen2016 G
Yuen2017 G
TENM4     1-0552-003chr11:
80321978-80321978
CGintergenicDe novo--Yuen2017 G
TENM4     2-1365-003 Complex Event; expand row to view variants  De novo--Yuen2016 G
Yuen2017 G
TENM4     11322.p1chr11:
78372516-78372516
GAexonicDe novononsynonymous SNVNM_001098816c.C7529Tp.T2510M25.64.507E-5Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Satterstrom2020 E
TENM4     AU4237302chr11:
80139500-80139500
GAintergenicDe novo--Yuen2017 G
TENM4     2-1591-003chr11:
78538157-78538157
ACintronicDe novo--Yuen2017 G
TENM4     AU046706chr11:
79885347-79885347
GAintergenicDe novo--Yuen2017 G
TENM4     7-0151-003chr11:
79325578-79325578
GAintergenicDe novo--Yuen2017 G
TENM4     AU4033303chr11:
78899248-78899248
AGintronicDe novo--Yuen2017 G
TENM4     1-0559-004chr11:
79465541-79465541
CTintergenicDe novo--Yuen2017 G
TENM4     AU3853302chr11:
80122331-80122331
ATintergenicDe novo--Yuen2017 G
TENM4     2-1268-003chr11:
79561453-79561453
CTintergenicDe novo--Yuen2016 G
Yuen2017 G
TENM4     2-1268-003chr11:
80324548-80324548
AGintergenicDe novo--Yuen2016 G
Yuen2017 G
TENM4     3-0080-000chr11:
78725215-78725215
CAintronicDe novo--Yuen2016 G
Yuen2017 G
TENM4     2-1134-003chr11:
78889732-78889732
AGintronicDe novo--Yuen2017 G
TENM4     2-1323-003chr11:
79993454-79993454
CGintergenicDe novo--Yuen2016 G
Yuen2017 G
TENM4     AU3724302chr11:
79563234-79563234
CTintergenicDe novo--Yuen2017 G
TENM4     1-0218-003chr11:
78935886-78935886
CTintronicDe novo--Yuen2017 G
TENM4     1-0169-003chr11:
79382845-79382845
CGintergenicDe novo--Yuen2017 G
TENM4     3-0446-000chr11:
80431353-80431353
TCintergenicDe novo--Yuen2016 G
Yuen2017 G
TENM4     2-1220-003chr11:
79313295-79313295
GAintergenicDe novo--Yuen2017 G
TENM4     AU4310301chr11:
80020796-80020796
CTintergenicDe novo--Yuen2017 G
TENM4     PN400527chr11:
78600956-78600956
GAexonicUnknownnonsynonymous SNVNM_001098816c.C958Tp.R320C22.5-Leblond2019 E
TENM4     2-1237-003chr11:
79200642-79200642
TCintergenicDe novo--Yuen2017 G
TENM4     AU3263301chr11:
78885979-78885979
TCintronicDe novo--Yuen2017 G
TENM4     1-0323-004chr11:
79696107-79696107
ACintergenicDe novo--Yuen2017 G
TENM4     2-1112-003 Complex Event; expand row to view variants  De novo--Yuen2016 G
Yuen2016 G
TENM4     AU008505chr11:
80411113-80411113
CAintergenicDe novo--Yuen2017 G
TENM4     2-0286-004chr11:
79947069-79947073
AAAACAintergenicDe novo--Yuen2017 G
TENM4     2-1380-003chr11:
78882933-78882933
GTintronicDe novo--Yuen2016 G
Yuen2017 G
TENM4     2-0003-004chr11:
79863310-79863310
TGintergenicDe novo--Yuen2017 G
TENM4     AU076508chr11:
79152917-79152917
CTintergenicDe novo--Yuen2017 G
TENM4     AU3052303chr11:
78954180-78954180
TGintronicDe novo--Yuen2017 G
TENM4     1-0413-003chr11:
80184764-80184764
GAintergenicDe novo--Yuen2017 G
TENM4     1-0112-004chr11:
79713160-79713160
TCintergenicDe novo--Yuen2017 G
TENM4     AU059903chr11:
80021662-80021662
GCintergenicDe novo--Yuen2017 G
TENM4     AU2109302chr11:
80294913-80294913
TCintergenicDe novo--Yuen2017 G
TENM4     AU3984302chr11:
78688798-78688798
GAintronicDe novo--Yuen2017 G
TENM4     AU3907301chr11:
78508054-78508054
AGintronicDe novo--Yuen2017 G
TENM4     AU072904chr11:
79314248-79314248
TCintergenicDe novo--Yuen2017 G
TENM4     AU1308303chr11:
79523167-79523167
GAintergenicDe novo--Yuen2017 G
TENM4     14153.p1chr11:
78395505-78395505
GAintronicDe novo--Turner2016 G
TENM4     1-0656-003chr11:
80064863-80064863
GAintergenicDe novo--Yuen2017 G
TENM4     11572.p1chr11:
78608885-78608885
AGintronicDe novo--Turner2016 G
TENM4     1-0138-003chr11:
80107757-80107757
AGintergenicDe novo--Yuen2017 G
TENM4     G01-GEA-313_HIchr11:
78482116-78482116
GAexonicDe novosynonymous SNVNM_001098816c.C2460Tp.V820V10.88-Satterstrom2020 E
TENM4     13069.p1chr11:
79669105-79669105
GAintergenicDe novo--Turner2016 G
TENM4     14153.p1chr11:
78722482-78722482
GAintronicDe novo--Turner2016 G
TENM4     14015.p1chr11:
79293732-79293732
CTintergenicDe novo--Turner2016 G
TENM4     AU3646301chr11:
79281481-79281481
CGintergenicDe novo--Yuen2017 G
TENM4     2-0006-004chr11:
79606614-79606614
GCintergenicDe novo--Yuen2017 G
TENM4     1-0032-003chr11:
79667065-79667065
GAintergenicDe novo--Yuen2017 G
TENM4     1-0454-003chr11:
80115025-80115025
TCintergenicDe novo--Yuen2016 G
Yuen2017 G
TENM4     2-1322-003chr11:
79259366-79259366
AGintergenicDe novo--Yuen2017 G
TENM4     2-1359-004chr11:
79879020-79879020
CTintergenicDe novo--Yuen2017 G
TENM4     1-0757-003chr11:
80319548-80319548
AGintergenicDe novo--Yuen2017 G
TENM4     AU050603chr11:
79576903-79576903
AGintergenicDe novo--Yuen2017 G
TENM4     2-0143-004chr11:
78529794-78529794
GCintronicDe novo--Yuen2017 G
TENM4     A18chr11:
79395949-79395949
TCintergenicDe novo--Wu2018 G
TENM4     PN400121chr11:
78600956-78600956
GAexonicUnknownnonsynonymous SNVNM_001098816c.C958Tp.R320C22.5-Leblond2019 E
TENM4     1-0299-003chr11:
79325828-79325828
CAintergenicDe novo--Yuen2017 G
TENM4     2-1437-004chr11:
80251687-80251687
AGintergenicDe novo--Yuen2017 G
TENM4     A23chr11:
78700966-78700966
GAintronicDe novo--Wu2018 G
TENM4     AU3861301chr11:
78758352-78758352
CTintronicDe novo--Yuen2017 G
TENM4     2-0043-003chr11:
79214694-79214694
AGintergenicDe novo--Yuen2016 G
Yuen2017 G
TENM4     AU4231301chr11:
79571673-79571673
AGintergenicDe novo--Yuen2017 G
TENM4     08C74799chr11:
78602317-78602317
CTexonicDe novononsynonymous SNVNM_001098816c.G814Ap.G272S11.574.618E-5Satterstrom2020 E
TENM4     A17chr11:
79079846-79079849
ATTGAintronicDe novo--Wu2018 G
TENM4     1-0295-003chr11:
79153451-79153451
CTintergenicDe novo--Yuen2017 G
TENM4     1-0359-003chr11:
79496504-79496504
TCintergenicDe novo--Yuen2017 G
TENM4     1-0972-003chr11:
79997053-79997053
GAintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More