or
or
Exact

Results for "NEGR1"

Variant Events: 93

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
NEGR1     1-0484-003chr1:
71938223-71938224
TGTintronicDe novo--Yuen2017 G
NEGR1     5-0064-003chr1:
73616625-73616625
TCintergenicDe novo--Yuen2017 G
NEGR1     AU049304chr1:
72330904-72330904
TCintronicDe novo--Yuen2017 G
NEGR1     5-0064-003chr1:
73618255-73618255
GAintergenicDe novo--Yuen2017 G
NEGR1     AU066403chr1:
72229828-72229828
CTintronicDe novo--Yuen2017 G
NEGR1     1-0067-005chr1:
73409957-73409957
TTAGGGACTGCintergenicDe novo--Yuen2017 G
NEGR1     5-0106-003chr1:
73679291-73679291
GAintergenicDe novo--Yuen2017 G
NEGR1     3-0438-000chr1:
73652213-73652213
TAintergenicDe novo--Yuen2016 G
NEGR1     1-0452-003chr1:
71955586-71955586
CTintronicDe novo--Yuen2016 G
NEGR1     1-0559-003chr1:
73107849-73107849
TAintergenicDe novo--Yuen2017 G
NEGR1     AU3891304chr1:
73289932-73289932
CTintergenicDe novo--Yuen2017 G
NEGR1     2-1152-003chr1:
71886690-71886690
TGintronicDe novo--Yuen2016 G
Yuen2017 G
NEGR1     5-0147-003chr1:
72979764-72979764
TCintergenicDe novo--Yuen2017 G
NEGR1     7-0253-003chr1:
73263173-73263173
GAintergenicDe novo--Yuen2017 G
NEGR1     1-0566-003chr1:
71934727-71934727
CTintronicDe novo--Yuen2017 G
NEGR1     5-0131-003chr1:
72638813-72638813
ACintronicDe novo--Yuen2017 G
NEGR1     5-0117-003chr1:
72384915-72384915
GTintronicDe novo--Yuen2017 G
NEGR1     AU031204chr1:
73335571-73335597
CAAGGAAGGAAGGAAGGAAGGAAGGAACAAGGAAGGAAGGAAGGAAGGAAintergenicDe novo--Yuen2017 G
NEGR1     AU4067303chr1:
73002283-73002283
AGintergenicDe novo--Yuen2017 G
NEGR1     AU3637301chr1:
73458766-73458766
GAintergenicDe novo--Yuen2017 G
NEGR1     1-0244-003chr1:
73582487-73582487
GTintergenicDe novo--Yuen2016 G
NEGR1     1-0261-003chr1:
72638847-72638847
AGintronicDe novo--Yuen2017 G
NEGR1     2-1085-004chr1:
73249612-73249612
GAintergenicDe novo--Yuen2017 G
NEGR1     AU3849302chr1:
71888351-71888351
CGintronicDe novo--Yuen2017 G
NEGR1     1-0570-003chr1:
71945560-71945560
CTintronicDe novo--Yuen2017 G
NEGR1     2-1299-003chr1:
73699658-73699658
CTintergenicDe novo--Yuen2017 G
NEGR1     7-0247-003chr1:
73737880-73737880
GAintergenicDe novo--Yuen2017 G
NEGR1     AU3761302chr1:
73383223-73383223
GTintergenicDe novo--Yuen2017 G
NEGR1     2-0116-004chr1:
72088700-72088700
TCintronicDe novo--Yuen2017 G
NEGR1     2-1132-003chr1:
73516049-73516049
AGintergenicDe novo--Yuen2017 G
NEGR1     3-0391-000chr1:
72649896-72649896
CGintronicDe novo--Yuen2017 G
NEGR1     2-1132-003chr1:
73323281-73323281
CTintergenicDe novo--Yuen2017 G
NEGR1     2-1255-003chr1:
71999844-71999848
ACCCCACCCintronicDe novo--Yuen2017 G
NEGR1     2-1475-003chr1:
72692763-72692763
TCintronicDe novo--Yuen2017 G
NEGR1     2-1475-003chr1:
71988647-71988647
CTintronicDe novo--Yuen2017 G
NEGR1     13946.p1chr1:
71976931-71976931
TAintronicDe novo--Turner2016 G
NEGR1     2-1303-003chr1:
73282774-73282774
CAintergenicDe novo--Yuen2016 G
Yuen2017 G
NEGR1     13515.p1chr1:
72256825-72256825
AGintronicDe novo--Turner2016 G
NEGR1     11252.p1chr1:
71927206-71927206
CTintronicDe novo--Turner2016 G
NEGR1     7-0175-003chr1:
73635192-73635192
AGintergenicDe novo--Yuen2017 G
NEGR1     2-1397-003chr1:
72520278-72520278
AGintronicDe novo--Yuen2017 G
NEGR1     AU2951302chr1:
72303022-72303022
GTintronicDe novo--Yuen2017 G
NEGR1     AU2951303chr1:
72303022-72303022
GTintronicDe novo--Yuen2017 G
NEGR1     13023.p1chr1:
73385468-73385468
TCintergenicDe novo--Turner2016 G
NEGR1     AU4356302chr1:
71892271-71892271
GAintronicDe novo--Yuen2017 G
NEGR1     7-0001-003chr1:
71767383-71767383
TCintergenicDe novo--Yuen2017 G
NEGR1     AU4145303chr1:
73460156-73460156
AATintergenicDe novo--Yuen2017 G
NEGR1     2-1168-003chr1:
73609619-73609619
ATintergenicDe novo--Yuen2016 G
Yuen2017 G
NEGR1     1-0455-003chr1:
72830751-72830751
GAintergenicDe novo--Yuen2017 G
NEGR1     1-0486-003chr1:
71774140-71774140
AGintergenicDe novo--Yuen2017 G
NEGR1     2-0286-003chr1:
73563382-73563382
AGintergenicDe novo--Yuen2017 G
NEGR1     AU3955303chr1:
72391383-72391383
TCintronicDe novo--Yuen2017 G
NEGR1     AU4103301chr1:
73295650-73295650
GAintergenicDe novo--Yuen2017 G
NEGR1     AU3680301chr1:
73740348-73740348
AGintergenicDe novo--Yuen2017 G
NEGR1     AU4191302chr1:
72636871-72636871
TGintronicDe novo--Yuen2017 G
NEGR1     2-0318-003chr1:
72320585-72320585
GAintronicDe novo--Yuen2017 G
NEGR1     AU3636302chr1:
72640192-72640192
CGintronicDe novo--Yuen2017 G
NEGR1     1-0582-003chr1:
72365189-72365189
TCintronicDe novo--Yuen2017 G
NEGR1     1-0582-003chr1:
72325394-72325394
CTintronicDe novo--Yuen2017 G
NEGR1     2-1085-003chr1:
72105378-72105378
CTintronicDe novo--Yuen2017 G
NEGR1     12651.p1chr1:
73542237-73542237
AGintergenicDe novo--Werling2018 G
NEGR1     1-0006-004chr1:
72638864-72638864
ATintronicDe novo--Yuen2017 G
NEGR1     2-1169-003chr1:
73089288-73089288
TCintergenicDe novo--Yuen2017 G
NEGR1     AU4306302chr1:
73477754-73477759
CCTTCTCCTTCTTCTintergenicDe novo--Yuen2017 G
NEGR1     AU006804chr1:
73192088-73192088
GAintergenicDe novo--Yuen2017 G
NEGR1     60-2027chr1:
72896715-72896715
GAintergenicDe novo--Michaelson2012 G
NEGR1     2-0013-003chr1:
72746404-72746404
ATintronicDe novo--Yuen2017 G
NEGR1     1-0512-003chr1:
72172100-72172100
TCintronicDe novo--Yuen2017 G
NEGR1     7-0106-003chr1:
73555214-73555214
CGintergenicDe novo--Yuen2017 G
NEGR1     1-0286-004chr1:
72612790-72612790
TCintronicDe novo--Yuen2017 G
NEGR1     1-0339-004chr1:
72875022-72875022
ATintergenicDe novo--Yuen2017 G
NEGR1     A2chr1:
73536256-73536256
GAintergenicDe novo--Wu2018 G
NEGR1     2-1702-003chr1:
72945953-72945953
CTintergenicDe novo--Yuen2017 G
NEGR1     AU031403chr1:
72540615-72540615
TCintronicDe novo--Yuen2017 G
NEGR1     5-0033-004chr1:
73382776-73382777
CTCintergenicDe novo--Yuen2017 G
NEGR1     7-0095-004chr1:
71721810-71721810
GCintergenicDe novo--Yuen2017 G
NEGR1     AU3777302chr1:
73631632-73631632
CGintergenicDe novo--Yuen2017 G
NEGR1     2-1277-003chr1:
72638813-72638813
ACintronicDe novo--Yuen2017 G
NEGR1     1-0482-003chr1:
73516291-73516291
CTintergenicDe novo--Yuen2016 G
Yuen2017 G
NEGR1     2-0219-004chr1:
72843696-72843696
AGintergenicDe novo--Yuen2017 G
NEGR1     2-1487-003chr1:
73301475-73301475
GAintergenicDe novo--Yuen2017 G
NEGR1     2-1635-004chr1:
72638864-72638864
ATintronicDe novo--Yuen2017 G
NEGR1     1-0668-003chr1:
72716084-72716084
AGintronicDe novo--Yuen2017 G
NEGR1     5-0133-003chr1:
73083385-73083385
GAintergenicDe novo--Yuen2017 G
NEGR1     AU072905chr1:
73624458-73624458
TCintergenicDe novo--Yuen2017 G
NEGR1     1-0668-003chr1:
72712564-72712564
GCintronicDe novo--Yuen2017 G
NEGR1     1-0668-003chr1:
72711574-72711574
GAintronicDe novo--Yuen2017 G
NEGR1     AU3517302chr1:
72028986-72028986
GAintronicDe novo--Yuen2017 G
NEGR1     3-0482-000chr1:
73457702-73457702
CTintergenicDe novo--Yuen2017 G
NEGR1     2-1690-003chr1:
71763310-71763310
GTintergenicDe novo--Yuen2017 G
NEGR1     2-1345-003chr1:
73267068-73267068
AGintergenicDe novo--Yuen2016 G
Yuen2017 G
NEGR1     AU2787301chr1:
73011082-73011082
GAintergenicDe novo--Yuen2017 G
NEGR1     AU3371301chr1:
72954693-72954693
TCintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More