or
or
Exact

Results for "LPAR1"

Variant Events: 34

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
LPAR1     2-1169-003chr9:
113875094-113875094
GCintergenicDe novo--Yuen2017 G
LPAR1     7-0103-003chr9:
113713847-113713847
AGintronicDe novo--Yuen2017 G
LPAR1     1-0269-003chr9:
113841374-113841374
GGGGTTAAintergenicDe novo--Yuen2017 G
LPAR1     5-0018-003chr9:
113976168-113976168
GAintergenicDe novo--Yuen2017 G
LPAR1     AU3729303chr9:
113997992-113997992
CAintergenicDe novo--Yuen2017 G
LPAR1     2-1355-003chr9:
113770726-113770726
ATintronicDe novo--Yuen2017 G
LPAR1     2-1105-003chr9:
113689389-113689389
AGintronicDe novo--Yuen2016 G
Yuen2017 G
LPAR1     200675739@1082034784chr9:
113704268-113704268
CAexonicDe novononsynonymous SNVNM_001401
NM_057159
c.G226T
c.G226T
p.V76F
p.V76F
16.943.0E-4Satterstrom2020 E
LPAR1     1-0439-003chr9:
113869328-113869328
GAintergenicDe novo--Yuen2016 G
Yuen2017 G
LPAR1     1-0925-003chr9:
113816957-113816957
GTintergenicDe novo--Yuen2017 G
LPAR1     AU2793303chr9:
113926785-113926786
CGCintergenicDe novo--Yuen2017 G
LPAR1     AU061003chr9:
113704571-113704571
ATintronicDe novo--Yuen2017 G
LPAR1     AU4410302chr9:
113778302-113778302
TCintronicDe novo--Yuen2017 G
LPAR1     2-1170-003chr9:
113907432-113907432
GGCTintergenicDe novo--Yuen2017 G
LPAR1     AU053503chr9:
113835028-113835028
GAintergenicDe novo--Yuen2017 G
LPAR1     1-0912-003chr9:
113836009-113836013
AATGTAintergenicDe novo--Yuen2017 G
LPAR1     7-0247-003chr9:
113730725-113730737
TCACACACACACATCACACACACAintronicDe novo--Yuen2017 G
LPAR1     1-0274-003chr9:
113682221-113682221
TCintronicDe novo--Yuen2017 G
LPAR1     AU058105chr9:
113942710-113942710
TCintergenicDe novo--Yuen2017 G
LPAR1     5-0099-003chr9:
113653457-113653457
TCintronicDe novo--Yuen2017 G
LPAR1     2-1383-003chr9:
113941932-113941932
TCintergenicDe novo--Yuen2017 G
LPAR1     1-0269-005chr9:
113841374-113841374
GGGGTTAAintergenicDe novo--Yuen2017 G
LPAR1     5-0041-003chr9:
114001165-114001165
ACintergenicDe novo--Yuen2017 G
LPAR1     AU4376301chr9:
113814829-113814829
GAintergenicDe novo--Yuen2017 G
LPAR1     2-1561-003chr9:
113667102-113667102
GAintronicDe novo--Yuen2017 G
LPAR1     AU015903chr9:
113714153-113714153
AGintronicDe novo--Yuen2017 G
LPAR1     1-0213-004chr9:
113730725-113730737
TCACACACACACATCACACACACAintronicDe novo--Yuen2017 G
LPAR1     1-0338-003chr9:
113907432-113907432
GGCTintergenicDe novo--Yuen2017 G
LPAR1     AU1725306chr9:
113758559-113758559
GAintronicDe novo--Yuen2017 G
LPAR1     1-0274-004chr9:
113682221-113682221
TCintronicDe novo--Yuen2017 G
LPAR1     2-1594-003chr9:
113963646-113963646
CTintergenicDe novo--Yuen2017 G
LPAR1     1-0995-003chr9:
113691244-113691244
TCintronicDe novo--Yuen2017 G
LPAR1     1-0160-004chr9:
113972933-113972933
TCintergenicDe novo--Yuen2017 G
LPAR1     1-0936-003chr9:
113818226-113818226
AGintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More