or
or
Exact

Results for "LINGO2"

Variant Events: 120

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
LINGO2     1-0191-003chr9:
28217652-28217652
TCintronicDe novo--Yuen2017 G
LINGO2     2-0063-005chr9:
28409950-28409950
CGintronicDe novo--Yuen2017 G
LINGO2     5-0040-003chr9:
30359106-30359106
TGintergenicDe novo--Yuen2017 G
LINGO2     2-1195-003chr9:
28681579-28681579
CTintronicDe novo--Yuen2016 G
Yuen2017 G
LINGO2     AU4211304chr9:
28559769-28559769
CTintronicDe novo--Yuen2017 G
LINGO2     2-0028-003chr9:
28066117-28066117
GAintronicDe novo--Yuen2016 G
Yuen2017 G
LINGO2     2-1153-003chr9:
29893340-29893340
CGintergenicDe novo--Yuen2016 G
Yuen2017 G
LINGO2     AU3997302chr9:
30283633-30283633
GCintergenicDe novo--Yuen2017 G
LINGO2     7-0249-004chr9:
29470879-29470879
TAintergenicDe novo--Yuen2017 G
LINGO2     AU0146301chr9:
29535496-29535496
ATintergenicDe novo--Yuen2017 G
LINGO2     60-2027chr9:
29063462-29063462
GAintronicInherited--Michaelson2012 G
LINGO2     74-0117chr9:
29256361-29256361
TCintergenicDe novo--Michaelson2012 G
LINGO2     AU2248302chr9:
28494874-28494874
CTintronicDe novo--Yuen2017 G
LINGO2     74-0117chr9:
28359591-28359591
ATintronicDe novo--Michaelson2012 G
LINGO2     63-449chr9:
28949138-28949138
CTintronicDe novo--Michaelson2012 G
LINGO2     1-0368-004chr9:
30365317-30365317
GTintergenicDe novo--Yuen2017 G
LINGO2     74-0355chr9:
30288864-30288864
TCintergenicDe novo--Michaelson2012 G
LINGO2     AU4473301chr9:
30166101-30166101
TCintergenicDe novo--Yuen2017 G
LINGO2     AU005214chr9:
28429929-28429929
AGintronicDe novo--Yuen2017 G
LINGO2     2-0210-005chr9:
29363270-29363270
CGintergenicDe novo--Yuen2017 G
LINGO2     2-1690-003chr9:
29163018-29163018
AGintronicDe novo--Yuen2017 G
LINGO2     AU076508chr9:
28799543-28799543
TCintronicDe novo--Yuen2017 G
LINGO2     AU1223301chr9:
29395203-29395203
TCintergenicDe novo--Yuen2017 G
LINGO2     1-0162-004chr9:
28171893-28171893
CGintronicDe novo--Yuen2017 G
LINGO2     1-0571-003chr9:
30129805-30129813
CTTTTTTTTCTTTTTTTintergenicDe novo--Yuen2017 G
LINGO2     1-0200-004chr9:
29397792-29397792
CTintergenicDe novo--Yuen2017 G
LINGO2     3-0140-000chr9:
30066231-30066231
TAintergenicDe novo--Yuen2017 G
LINGO2     1-0862-003chr9:
30272664-30272664
AGintergenicDe novo--Yuen2017 G
LINGO2     AU3794301chr9:
28541619-28541619
GAintronicDe novo--Yuen2017 G
LINGO2     1-0382-003chr9:
30166062-30166062
GAintergenicDe novo--Yuen2017 G
LINGO2     2-0116-004chr9:
29638100-29638100
AGintergenicDe novo--Yuen2017 G
LINGO2     2-1177-003chr9:
29340608-29340631
TTTTGTTTGTTTGTTTGTTTGTTTTTTTGTTTGTTTGTTTGTTTintergenicDe novo--Yuen2017 G
LINGO2     1-0455-004chr9:
28731447-28731447
TCintronicDe novo--Yuen2017 G
LINGO2     AU1640302chr9:
29884558-29884558
TCintergenicDe novo--Yuen2017 G
LINGO2     1-0455-004chr9:
28680740-28680740
AGintronicDe novo--Yuen2017 G
LINGO2     1-0338-005chr9:
28100810-28100810
AGintronicDe novo--Yuen2017 G
LINGO2     AU4032306chr9:
29903205-29903205
GTintergenicDe novo--Yuen2017 G
LINGO2     AU2123301chr9:
28639183-28639183
CTintronicDe novo--Yuen2017 G
LINGO2     AU2123301chr9:
28671232-28671232
GAintronicDe novo--Yuen2017 G
LINGO2     2-0007-004chr9:
28127469-28127469
AGintronicDe novo--Yuen2017 G
LINGO2     2-1441-003chr9:
28649156-28649156
CAintronicDe novo--Yuen2016 G
Yuen2017 G
LINGO2     1-0565-004chr9:
29202391-29202391
TTTAAintronicDe novo--Yuen2017 G
LINGO2     AU4237304chr9:
28829763-28829763
CTintronicDe novo--Yuen2017 G
LINGO2     2-1094-004chr9:
29886376-29886376
GAintergenicDe novo--Yuen2017 G
LINGO2     2-1454-003chr9:
29754841-29754841
ATintergenicDe novo--Yuen2017 G
LINGO2     AU4284301chr9:
29545722-29545725
TACATAintergenicDe novo--Yuen2017 G
LINGO2     1-0701-003chr9:
28133236-28133236
AGintronicDe novo--Yuen2017 G
LINGO2     2-0002-005chr9:
29312542-29312542
ACintergenicDe novo--Yuen2017 G
LINGO2     AU000704chr9:
28289241-28289241
CGintronicDe novo--Yuen2017 G
LINGO2     1-0569-003chr9:
29700135-29700135
CAintergenicDe novo--Yuen2017 G
LINGO2     2-1375-003chr9:
28995517-28995517
GCintronicDe novo--Yuen2017 G
LINGO2     2-0503-003chr9:
30224431-30224431
AGintergenicDe novo--Yuen2017 G
LINGO2     1-0560-003chr9:
29020136-29020136
ACintronicDe novo--Yuen2017 G
LINGO2     AU3263302chr9:
29026735-29026735
GAintronicDe novo--Yuen2017 G
LINGO2     AU071703chr9:
28366049-28366049
ACintronicDe novo--Yuen2017 G
LINGO2     AU0636303chr9:
29779914-29779923
TTTCTGTTCTTTTCTintergenicDe novo--Yuen2017 G
LINGO2     1-0051-004chr9:
30188549-30188550
TATintergenicDe novo--Yuen2017 G
LINGO2     2-1264-003chr9:
30139082-30139097
CTGTGTGTGTGTGTGTCTGTGTGTGTGTGTintergenicDe novo--Yuen2017 G
LINGO2     2-0135-004chr9:
28764072-28764072
ACintronicDe novo--Yuen2017 G
LINGO2     AU3906301chr9:
28283509-28283509
GCintronicDe novo--Yuen2017 G
LINGO2     2-0070-003chr9:
28899580-28899580
GTintronicDe novo--Yuen2017 G
LINGO2     AU4467302chr9:
29662066-29662066
GAintergenicDe novo--Yuen2017 G
LINGO2     1-0184-003chr9:
30123305-30123305
GTintergenicDe novo--Yuen2017 G
LINGO2     1-0552-003chr9:
29429316-29429316
GAintergenicDe novo--Yuen2017 G
LINGO2     5-0018-003chr9:
29648658-29648662
TAAACTintergenicDe novo--Yuen2017 G
LINGO2     1-0863-003chr9:
28640063-28640063
CTintronicDe novo--Yuen2017 G
LINGO2     AU2410302chr9:
29801362-29801363
TATintergenicDe novo--Yuen2017 G
LINGO2     1-0651-003chr9:
30317562-30317562
CTintergenicDe novo--Yuen2017 G
LINGO2     2-1213-003chr9:
29548758-29548758
CTintergenicDe novo--Yuen2017 G
LINGO2     2-1510-003chr9:
30357050-30357050
GAintergenicDe novo--Yuen2017 G
LINGO2     AU065807chr9:
28075340-28075340
GAintronicDe novo--Yuen2017 G
LINGO2     AU3506302chr9:
29689993-29689993
CTintergenicDe novo--Yuen2017 G
LINGO2     1-0403-004chr9:
29361745-29361745
GAintergenicDe novo--Yuen2017 G
LINGO2     1-0591-003chr9:
30303858-30303858
TCintergenicDe novo--Yuen2017 G
LINGO2     2-1345-003chr9:
28051878-28051878
GCintronicDe novo--Yuen2016 G
Yuen2017 G
LINGO2     1-0564-003chr9:
28212987-28212987
TGintronicDe novo--Yuen2017 G
LINGO2     2-0202-003chr9:
29595372-29595372
TCintergenicDe novo--Yuen2017 G
LINGO2     AU2793301chr9:
29037862-29037862
TCintronicDe novo--Yuen2017 G
LINGO2     2-1244-003chr9:
28945384-28945384
AGintronicDe novo--Yuen2016 G
Yuen2017 G
LINGO2     AU025704chr9:
28371535-28371535
CGintronicDe novo--Yuen2017 G
LINGO2     AU3779302chr9:
28977276-28977276
CTintronicDe novo--Yuen2017 G
LINGO2     2-1451-003chr9:
29175956-29175956
GCintronicDe novo--Yuen2017 G
LINGO2     1-0467-003chr9:
29467752-29467752
GCintergenicDe novo--Yuen2017 G
LINGO2     2-1173-003chr9:
30196080-30196080
AGintergenicDe novo--Yuen2017 G
LINGO2     SP0034714chr9:
27949836-27949836
AGexonicDe novosynonymous SNVNM_001258282
NM_152570
c.T834C
c.T834C
p.L278L
p.L278L
--Feliciano2019 E
LINGO2     1-0524-003chr9:
30092404-30092410
GACAGATGintergenicDe novo--Yuen2016 G
Yuen2017 G
LINGO2     AU4327303chr9:
30368435-30368437
TGATGAAGAintergenicDe novo--Yuen2017 G
LINGO2     1-0010-005chr9:
28231611-28231611
CGintronicDe novo--Yuen2017 G
LINGO2     2-1152-003chr9:
28108619-28108619
CTintronicDe novo--Yuen2016 G
Yuen2017 G
LINGO2     2-0127-004chr9:
28614227-28614227
TAintronicDe novo--Yuen2017 G
LINGO2     2-1315-003chr9:
28387482-28387482
TCintronicDe novo--Yuen2016 G
Yuen2017 G
LINGO2     AU073005chr9:
29139788-29139788
GTintronicDe novo--Yuen2017 G
LINGO2     AU011704chr9:
29256361-29256361
TCintergenicDe novo--Yuen2017 G
LINGO2     A17chr9:
30077919-30077919
AGintergenicDe novo--Wu2018 G
LINGO2     AU011704chr9:
28359591-28359591
ATintronicDe novo--Yuen2017 G
LINGO2     AU3646301chr9:
29484933-29484942
CTTTAGTTTACTTTAintergenicDe novo--Yuen2017 G
LINGO2     AU4089301chr9:
28126941-28126941
CAintronicDe novo--Yuen2017 G
LINGO2     1-0180-004chr9:
28235048-28235048
GAintronicDe novo--Yuen2017 G
LINGO2     2-0503-004chr9:
30224431-30224431
AGintergenicDe novo--Yuen2017 G
LINGO2     7-0001-003chr9:
29710563-29710563
GAintergenicDe novo--Yuen2017 G
LINGO2     3-0438-000chr9:
28636289-28636291
CATCintronicDe novo--Yuen2016 G
LINGO2     13171.p1chr9:
28142301-28142301
AGintronicDe novo--Turner2016 G
LINGO2     1-0973-003chr9:
29933186-29933186
CTintergenicDe novo--Yuen2017 G
LINGO2     1-0354-003chr9:
28560994-28560994
TCintronicDe novo--Yuen2017 G
LINGO2     1-0973-003chr9:
29154712-29154712
GCintronicDe novo--Yuen2017 G
LINGO2     14153.p1chr9:
29706081-29706081
TCintergenicDe novo--Turner2016 G
LINGO2     13393.p1chr9:
30259585-30259585
CAintergenicDe novo--Turner2016 G
LINGO2     13023.p1chr9:
28725582-28725582
GAintronicDe novo--Turner2016 G
LINGO2     13171.p1chr9:
28821750-28821750
GAintronicDe novo--Turner2016 G
LINGO2     2-1375-003chr9:
28989797-28989797
TCintronicDe novo--Yuen2016 G
Yuen2017 G
LINGO2     AU3889305chr9:
28993158-28993158
AGintronicDe novo--Yuen2017 G
LINGO2     5-0123-003chr9:
30174507-30174507
ATintergenicDe novo--Yuen2017 G
LINGO2     1-0565-003chr9:
29202391-29202391
TTTAAintronicDe novo--Yuen2017 G
LINGO2     2-1529-003chr9:
29346097-29346097
CTintergenicDe novo--Yuen2017 G
LINGO2     2-1529-003chr9:
29207131-29207144
AATATATATATATAAATATATATATAintronicDe novo--Yuen2017 G
LINGO2     AU4054301chr9:
29462173-29462173
TCintergenicDe novo--Yuen2017 G
LINGO2     1-0486-003chr9:
29290331-29290331
CTintergenicDe novo--Yuen2017 G
LINGO2     2-1280-003chr9:
29535581-29535596
AACACACACACACACAAACACACACACACAintergenicDe novo--Yuen2017 G
LINGO2     1-0652-003chr9:
28976920-28976920
TCintronicDe novo--Yuen2017 G
LINGO2     AU002406chr9:
28672255-28672255
CTintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More