or
or
Exact

Results for "CTSO"

Variant Events: 35

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
CTSO     1-0252-003chr4:
157116978-157116978
TTTATTATTAGTAGTAGTAGTAACAintergenicDe novo--Yuen2017 G
CTSO     2-0307-004chr4:
157151847-157151847
GTintergenicDe novo--Yuen2017 G
CTSO     1-0121-003chr4:
157209119-157209119
CTintergenicDe novo--Yuen2017 G
CTSO     AU058105chr4:
157050387-157050387
TAintergenicDe novo--Yuen2017 G
CTSO     AU3779301chr4:
157401021-157401021
CTintergenicDe novo--Yuen2017 G
CTSO     2-1562-004chr4:
156974655-156974655
GTintergenicDe novo--Yuen2017 G
CTSO     1-0994-003chr4:
156923658-156923673
TACACACACACACACATACACACACACACAintergenicDe novo--Yuen2017 G
CTSO     2-1416-004chr4:
156969866-156969866
CGintergenicDe novo--Yuen2017 G
CTSO     2-0223-004chr4:
157366175-157366175
TTCTTTCintergenicDe novo--Yuen2017 G
CTSO     AU047704chr4:
157053885-157053885
AGintergenicDe novo--Yuen2017 G
CTSO     AU4231301chr4:
157226642-157226642
GAintergenicDe novo--Yuen2017 G
CTSO     1-0882-003 Complex Event; expand row to view variants  De novo--Yuen2017 G
Yuen2017 G
CTSO     2-1339-003chr4:
157063197-157063197
AAATAAACintergenicDe novo--Yuen2017 G
CTSO     7-0188-003chr4:
157557728-157557731
GGTAGGTAGTAintergenicDe novo--Yuen2017 G
CTSO     AU4452302chr4:
157175029-157175029
CTintergenicDe novo--Yuen2017 G
CTSO     3-0307-000chr4:
157062676-157062676
GAintergenicDe novo--Yuen2017 G
CTSO     1-0181-004chr4:
157191603-157191603
AGintergenicDe novo--Yuen2017 G
CTSO     1-0059-003chr4:
157677177-157677181
GCTGAGintergenicDe novo--Yuen2017 G
CTSO     AU030804chr4:
157665737-157665737
CGintergenicDe novo--Yuen2017 G
CTSO     1-0051-005chr4:
157017082-157017082
TTTGCintergenicDe novo--Yuen2017 G
CTSO     1-0436-003chr4:
157288705-157288705
CTintergenicDe novo--Yuen2017 G
CTSO     5-0064-003chr4:
156870410-156870410
GTintronicDe novo--Yuen2017 G
CTSO     2-0057-004chr4:
157063197-157063197
AAATAAACintergenicDe novo--Yuen2017 G
CTSO     AU060803chr4:
157317902-157317902
TGintergenicDe novo--Yuen2017 G
CTSO     5-0025-003chr4:
157445124-157445124
GCintergenicDe novo--Yuen2017 G
CTSO     AU4069301chr4:
157352559-157352559
CTintergenicDe novo--Yuen2017 G
CTSO     1-0433-004chr4:
156917079-156917079
TGintergenicDe novo--Yuen2017 G
CTSO     1-0321-004chr4:
157484109-157484109
TCintergenicDe novo--Yuen2017 G
CTSO     AU050604chr4:
156956990-156956990
AGintergenicDe novo--Yuen2017 G
CTSO     1-0388-003chr4:
157019273-157019273
TCintergenicDe novo--Yuen2017 G
CTSO     1-0445-003chr4:
157153885-157153885
GCintergenicDe novo--Yuen2017 G
CTSO     2-1085-004chr4:
157656833-157656833
GAintergenicDe novo--Yuen2017 G
CTSO     2-1605-003chr4:
157590790-157590790
GAintergenicDe novo--Yuen2017 G
CTSO     2-1105-003chr4:
157351265-157351265
TCintergenicDe novo--Yuen2016 G
Yuen2017 G
CTSO     AU2777302chr4:
157178270-157178270
GAintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More