or
or
Exact

Results for "LRFN5"

Variant Events: 115

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
LRFN5     1-0559-005chr14:
43262125-43262125
ATintergenicDe novo--Yuen2017 G
LRFN5     1-0885-003chr14:
42140163-42140166
CAATCintronicDe novo--Yuen2017 G
LRFN5     AU045010chr14:
42666605-42666605
GTintergenicDe novo--Yuen2017 G
LRFN5     1-0186-004chr14:
44008128-44008128
TCintergenicDe novo--Yuen2017 G
LRFN5     A4chr14:
43332599-43332599
GAintergenicDe novo--Wu2018 G
LRFN5     2-1105-003chr14:
44062902-44062902
CTintergenicDe novo--Yuen2017 G
LRFN5     1-0186-004chr14:
44390061-44390061
GCintergenicDe novo--Yuen2017 G
LRFN5     1-0225-003chr14:
42610746-42610746
AGintergenicDe novo--Yuen2017 G
LRFN5     2-1210-003chr14:
42746168-42746168
CTintergenicDe novo--Yuen2017 G
LRFN5     2-1352-003chr14:
44288502-44288502
GAintergenicDe novo--Yuen2016 G
Yuen2017 G
LRFN5     UK10K_SKUSE5080221chr14:
42356586-42356586
GAexonicDe novononsynonymous SNVNM_152447c.G758Ap.R253H20.5-DeRubeis2014 E
Kosmicki2017 E
Lim2017 E
Satterstrom2020 E
LRFN5     1-0871-003chr14:
44270836-44270836
CTintergenicDe novo--Yuen2017 G
LRFN5     2-0319-003chr14:
44117488-44117488
CTintergenicDe novo--Yuen2017 G
LRFN5     1-0387-003chr14:
44383612-44383612
CTintergenicDe novo--Yuen2016 G
Yuen2017 G
LRFN5     AU1933302chr14:
42802675-42802675
TCintergenicDe novo--Yuen2017 G
LRFN5     1-0541-003chr14:
42528605-42528605
TCintergenicDe novo--Yuen2017 G
LRFN5     1-0300-004chr14:
43143300-43143300
GAintergenicDe novo--Yuen2017 G
LRFN5     7-0123-003chr14:
42881426-42881426
CAintergenicDe novo--Yuen2017 G
LRFN5     AU3840302chr14:
42489133-42489133
GAintergenicDe novo--Yuen2017 G
LRFN5     2-1086-003chr14:
42740184-42740184
CTintergenicDe novo--Yuen2017 G
LRFN5     1-0352-005chr14:
43228505-43228505
ACintergenicDe novo--Yuen2017 G
LRFN5     2-0135-003chr14:
43914977-43914981
TTTTATintergenicDe novo--Yuen2017 G
LRFN5     1-0019-004chr14:
44128312-44128312
GAintergenicDe novo--Yuen2017 G
LRFN5     AU005214chr14:
42271503-42271503
TCintronicDe novo--Yuen2017 G
LRFN5     2-1715-004chr14:
43579861-43579861
TCintergenicDe novo--Yuen2017 G
LRFN5     AU3763305chr14:
44086469-44086469
GCintergenicDe novo--Yuen2017 G
LRFN5     AU4452302chr14:
42798939-42798939
TCintergenicDe novo--Yuen2017 G
LRFN5     2-1366-004chr14:
43162416-43162416
GAintergenicDe novo--Yuen2017 G
LRFN5     1-0150-004chr14:
42270712-42270712
CTintronicDe novo--Yuen2017 G
LRFN5     AU3605303chr14:
42811331-42811331
AGintergenicDe novo--Yuen2017 G
LRFN5     AU3912301chr14:
43812269-43812269
TGintergenicDe novo--Yuen2017 G
LRFN5     1-0834-003chr14:
43918454-43918454
GAintergenicDe novo--Yuen2017 G
LRFN5     1-0965-003chr14:
43540756-43540763
GAAAAAAAGAAAAAAintergenicDe novo--Yuen2017 G
LRFN5     2-1509-003chr14:
42078625-42078625
AGintronicDe novo--Yuen2017 G
LRFN5     1-0551-004chr14:
43921441-43921445
CTGAGCintergenicDe novo--Yuen2017 G
LRFN5     AU024104chr14:
43932513-43932513
CTintergenicDe novo--Yuen2017 G
LRFN5     1-0563-004chr14:
43445441-43445441
GAintergenicDe novo--Yuen2017 G
LRFN5     1-0559-003chr14:
42079870-42079870
AACintronicDe novo--Yuen2017 G
LRFN5     1-0325-003chr14:
43460997-43460997
CTintergenicDe novo--Yuen2017 G
LRFN5     1-0352-003chr14:
43228505-43228505
ACintergenicDe novo--Yuen2016 G
LRFN5     AU1909304chr14:
42243183-42243183
CGintronicDe novo--Yuen2017 G
LRFN5     1-0200-004chr14:
42460624-42460624
GAintergenicDe novo--Yuen2017 G
LRFN5     AU2165301chr14:
43088683-43088683
GAintergenicDe novo--Yuen2017 G
LRFN5     1-0683-003chr14:
43973127-43973127
GTintergenicDe novo--Yuen2017 G
LRFN5     2-1105-003chr14:
43713154-43713154
CTintergenicDe novo--Yuen2016 G
Yuen2017 G
LRFN5     1-0004-003chr14:
43443655-43443658
CGTTCintergenicDe novo--Yuen2017 G
LRFN5     AU3918301chr14:
43071376-43071376
GAintergenicDe novo--Yuen2017 G
LRFN5     1-0518-003chr14:
42839999-42839999
TGintergenicDe novo--Yuen2016 G
LRFN5     1-0171-005chr14:
43421799-43421803
TAGACTintergenicDe novo--Yuen2017 G
LRFN5     2-0143-004chr14:
43745553-43745553
ATintergenicDe novo--Yuen2017 G
LRFN5     AU3846302chr14:
43930030-43930030
AGintergenicDe novo--Yuen2017 G
LRFN5     AU3955303chr14:
44358005-44358005
GTintergenicDe novo--Yuen2017 G
LRFN5     1-0488-003chr14:
44052691-44052691
TAintergenicDe novo--Yuen2017 G
LRFN5     1-0488-003chr14:
42613898-42613898
AGintergenicDe novo--Yuen2017 G
LRFN5     3-0307-000chr14:
42165471-42165471
TCintronicDe novo--Yuen2017 G
LRFN5     AU3761301chr14:
42954708-42954708
ACintergenicDe novo--Yuen2017 G
LRFN5     2-1562-004chr14:
43167735-43167735
CAintergenicDe novo--Yuen2017 G
LRFN5     2-1114-003chr14:
42088542-42088542
GAintronicDe novo--Yuen2017 G
LRFN5     2-1722-003chr14:
43523258-43523258
CGintergenicDe novo--Yuen2017 G
LRFN5     AU3605304chr14:
42811331-42811331
AGintergenicDe novo--Yuen2017 G
LRFN5     AU3175303chr14:
43455425-43455425
CTintergenicDe novo--Yuen2017 G
LRFN5     5-0077-004chr14:
44024985-44024985
AACATGintergenicDe novo--Yuen2017 G
LRFN5     AU4462302chr14:
44195996-44195996
GCintergenicDe novo--Yuen2017 G
LRFN5     AU4235303chr14:
43706633-43706633
AGintergenicDe novo--Yuen2017 G
LRFN5     2-0057-004chr14:
43330734-43330734
CCTAATTintergenicDe novo--Yuen2017 G
LRFN5     1-0028-003chr14:
44193735-44193735
AGintergenicDe novo--Yuen2017 G
LRFN5     AU050704chr14:
42144390-42144390
TGintronicDe novo--Yuen2017 G
LRFN5     AU006804chr14:
43910637-43910637
AGintergenicDe novo--Yuen2017 G
LRFN5     1-0296-004chr14:
43448100-43448100
TCintergenicDe novo--Yuen2017 G
LRFN5     AU3849303chr14:
43216794-43216794
CAintergenicDe novo--Yuen2017 G
LRFN5     AU3849303chr14:
43295712-43295712
GTintergenicDe novo--Yuen2017 G
LRFN5     AU051504chr14:
43854283-43854283
GAintergenicDe novo--Yuen2017 G
LRFN5     AU4092302chr14:
42148831-42148831
GAintronicDe novo--Yuen2017 G
LRFN5     AU2485305chr14:
43730253-43730253
AGintergenicDe novo--Yuen2017 G
LRFN5     AU3725302chr14:
43906916-43906916
AGintergenicDe novo--Yuen2017 G
LRFN5     AU3725302chr14:
43909959-43909959
CTintergenicDe novo--Yuen2017 G
LRFN5     3-0437-000chr14:
42653916-42653916
ACintergenicDe novo--Yuen2016 G
LRFN5     1-0651-003chr14:
42986208-42986208
TAintergenicDe novo--Yuen2017 G
LRFN5     A12chr14:
43470903-43470903
GAintergenicDe novo--Wu2018 G
LRFN5     2-1487-003chr14:
42597061-42597061
GAintergenicDe novo--Yuen2017 G
LRFN5     AU3728301chr14:
42669430-42669430
AGintergenicDe novo--Yuen2017 G
LRFN5     AU4286302chr14:
42916937-42916937
GAintergenicDe novo--Yuen2017 G
LRFN5     AU2950301chr14:
43842792-43842792
GAintergenicDe novo--Yuen2017 G
LRFN5     AU078503chr14:
42306574-42306574
GTintronicDe novo--Yuen2017 G
LRFN5     AU4429301chr14:
44229496-44229496
CAintergenicDe novo--Yuen2017 G
LRFN5     AU063004chr14:
42754711-42754711
GTintergenicDe novo--Yuen2017 G
LRFN5     1-0320-004chr14:
43623152-43623152
GAintergenicDe novo--Yuen2017 G
LRFN5     2-1709-003chr14:
42631756-42631756
TAintergenicDe novo--Yuen2017 G
LRFN5     1-0382-004chr14:
43947098-43947098
CAintergenicDe novo--Yuen2017 G
LRFN5     1-0459-003chr14:
43453859-43453859
TTAAAGintergenicDe novo--Yuen2017 G
LRFN5     1-0278-003chr14:
43633547-43633547
GAintergenicDe novo--Yuen2016 G
LRFN5     AU4310301chr14:
42077102-42077102
CTUTR5De novo--Yuen2017 G
LRFN5     AU3862305chr14:
43722084-43722084
CAintergenicDe novo--Yuen2017 G
LRFN5     1-0522-003chr14:
42928518-42928518
CTintergenicDe novo--Yuen2016 G
Yuen2017 G
LRFN5     1-0010-005chr14:
44236845-44236845
TCintergenicDe novo--Yuen2017 G
LRFN5     2-1408-004chr14:
42365049-42365050
GAGintronicDe novo--Yuen2017 G
LRFN5     11252.p1chr14:
43097321-43097321
GAintergenicDe novo--Turner2016 G
LRFN5     11341.p1chr14:
42466213-42466213
AGintergenicDe novo--Turner2016 G
LRFN5     2-1089-003chr14:
42242144-42242144
CTintronicDe novo--Yuen2017 G
LRFN5     13951.p1chr14:
42850519-42850519
ACintergenicDe novo--Turner2016 G
LRFN5     AU3692302chr14:
42418915-42418915
AGintergenicDe novo--Yuen2017 G
LRFN5     7-0133-003chr14:
43148510-43148510
GAintergenicDe novo--Yuen2017 G
LRFN5     2-1338-003chr14:
44198772-44198772
TGintergenicDe novo--Yuen2017 G
LRFN5     2-1132-003chr14:
43042248-43042248
TGintergenicDe novo--Yuen2017 G
LRFN5     AU3692302chr14:
43673043-43673054
CTATATATATATCTATATATATATATintergenicDe novo--Yuen2017 G
LRFN5     1-0490-003chr14:
43123882-43123882
GAintergenicDe novo--Yuen2017 G
LRFN5     AU1308303chr14:
42980370-42980370
GAintergenicDe novo--Yuen2017 G
LRFN5     AU3903301chr14:
43148881-43148881
CGintergenicDe novo--Yuen2017 G
LRFN5     A8chr14:
43030488-43030489
AGAintergenicDe novo--Wu2018 G
LRFN5     2-0109-003chr14:
44185438-44185438
TAintergenicDe novo--Yuen2017 G
LRFN5     AU017704chr14:
44293218-44293226
ATAGTTAGTATAGTintergenicDe novo--Yuen2017 G
LRFN5     1-0757-003chr14:
43470714-43470714
CTintergenicDe novo--Yuen2017 G
LRFN5     AU4191302chr14:
43709249-43709253
TGAAGTGintergenicDe novo--Yuen2017 G
LRFN5     1-0669-003chr14:
42076361-42076361
GTupstreamDe novo--Yuen2017 G
LRFN5     AU3765302chr14:
44386146-44386146
CTintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More