or
or
Exact

Results for "OTOL1"

Variant Events: 84

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
OTOL1     2-1487-003chr3:
161344731-161344731
GAintergenicDe novo--Yuen2017 G
OTOL1     1-0533-003chr3:
161966140-161966141
GAGintergenicDe novo--Yuen2017 G
OTOL1     AU0540301chr3:
161436773-161436773
TAintergenicDe novo--Yuen2017 G
OTOL1     AU2793301chr3:
162851502-162851505
CTATCTintergenicDe novo--Yuen2017 G
OTOL1     AU011021chr3:
162238144-162238144
CTintergenicDe novo--Yuen2017 G
OTOL1     1-0625-003chr3:
162497894-162497894
AAACintergenicDe novo--Yuen2017 G
OTOL1     2-1329-003chr3:
161671576-161671576
TGintergenicDe novo--Yuen2016 G
Yuen2017 G
OTOL1     AU4379301chr3:
161981050-161981050
GAintergenicDe novo--Yuen2017 G
OTOL1     AU3371301chr3:
161696178-161696178
CGintergenicDe novo--Yuen2017 G
OTOL1     1-0395-003chr3:
161425672-161425672
GAintergenicDe novo--Yuen2017 G
OTOL1     A26chr3:
162343943-162343943
TAintergenicDe novo--Wu2018 G
OTOL1     AU3051302chr3:
161990281-161990281
TCintergenicDe novo--Yuen2017 G
OTOL1     AU008505chr3:
162326277-162326277
AGintergenicDe novo--Yuen2017 G
OTOL1     2-1366-003chr3:
162251260-162251260
GTintergenicDe novo--Yuen2017 G
OTOL1     1-0406-003chr3:
161533915-161533915
CAintergenicDe novo--Yuen2017 G
OTOL1     1-0075-003chr3:
162691704-162691704
ATintergenicDe novo--Yuen2017 G
OTOL1     1-0261-004chr3:
162052082-162052082
CCTGATintergenicDe novo--Yuen2017 G
OTOL1     2-1276-003chr3:
161908396-161908396
GCintergenicDe novo--Yuen2016 G
Yuen2017 G
OTOL1     2-1594-003chr3:
162468605-162468605
TCintergenicDe novo--Yuen2017 G
OTOL1     7-0100-003chr3:
161642403-161642408
AATTACAintergenicDe novo--Yuen2017 G
OTOL1     5-0073-003chr3:
161312971-161312971
CGintergenicDe novo--Yuen2017 G
OTOL1     5-0073-003chr3:
162257654-162257654
TCintergenicDe novo--Yuen2017 G
OTOL1     AU3782302chr3:
161466409-161466409
CTintergenicDe novo--Yuen2017 G
OTOL1     AU3808305chr3:
161295112-161295112
GTintergenicDe novo--Yuen2017 G
OTOL1     1-0862-003chr3:
161457351-161457352
ATAintergenicDe novo--Yuen2017 G
OTOL1     AU3175302chr3:
161791871-161791871
CGintergenicDe novo--Yuen2017 G
OTOL1     1-0976-003chr3:
162288240-162288240
TCintergenicDe novo--Yuen2017 G
OTOL1     2-1459-003chr3:
161337295-161337295
GAintergenicDe novo--Yuen2016 G
Yuen2017 G
OTOL1     AU4122301chr3:
161802608-161802616
AATCTATCTAATCTintergenicDe novo--Yuen2017 G
OTOL1     1-0530-003chr3:
162006535-162006535
GAintergenicDe novo--Yuen2016 G
Yuen2017 G
OTOL1     1-0121-003chr3:
162251026-162251026
TGintergenicDe novo--Yuen2017 G
OTOL1     1-0121-003chr3:
161857570-161857570
AGintergenicDe novo--Yuen2017 G
OTOL1     2-1475-003chr3:
162848496-162848496
GAintergenicDe novo--Yuen2017 G
OTOL1     1-0332-003chr3:
162272789-162272789
CTintergenicDe novo--Yuen2017 G
OTOL1     2-0110-003chr3:
162144147-162144147
CTintergenicDe novo--Yuen2016 G
Yuen2017 G
OTOL1     AU058105chr3:
162582345-162582350
CATTTACAintergenicDe novo--Yuen2017 G
OTOL1     AU4015303chr3:
161219507-161219507
AGintronicDe novo--Yuen2017 G
OTOL1     2-0045-003chr3:
161250923-161250923
AGintergenicDe novo--Yuen2016 G
Yuen2017 G
OTOL1     14670.p1chr3:
161217077-161217077
AAGintronicDe novo--Iossifov2014 E
Kosmicki2017 E
Satterstrom2020 E
OTOL1     AU074403chr3:
161943986-161943988
CATCintergenicDe novo--Yuen2017 G
OTOL1     AU079605chr3:
161598418-161598418
TCintergenicDe novo--Yuen2017 G
OTOL1     AU2292301chr3:
162646533-162646537
CAAAACAAAintergenicDe novo--Yuen2017 G
OTOL1     1-0354-003chr3:
162491840-162491840
TTATAACATGAATCAAintergenicDe novo--Yuen2017 G
OTOL1     2-1357-004chr3:
162856193-162856193
AGintergenicDe novo--Yuen2017 G
OTOL1     2-0238-004chr3:
162182031-162182048
CTTCACCAGCATCTGTTACintergenicDe novo--Yuen2017 G
OTOL1     AU4164301chr3:
161524587-161524592
TATCATTATintergenicDe novo--Yuen2017 G
OTOL1     2-0223-003chr3:
161982128-161982128
GTintergenicDe novo--Yuen2017 G
OTOL1     AU3846302chr3:
162273605-162273616
CTTTGTTTGTTTCTTTGTTTintergenicDe novo--Yuen2017 G
OTOL1     AU4145303chr3:
162693150-162693150
AGintergenicDe novo--Yuen2017 G
OTOL1     2-1094-004chr3:
162651207-162651207
CAintergenicDe novo--Yuen2017 G
OTOL1     1-0486-003chr3:
161760666-161760666
TCintergenicDe novo--Yuen2017 G
OTOL1     3-0439-000chr3:
161938531-161938531
GAintergenicDe novo--Yuen2016 G
OTOL1     1-0259-005chr3:
161258645-161258645
TAintergenicDe novo--Yuen2017 G
OTOL1     1-0274-004chr3:
161338618-161338618
GAintergenicDe novo--Yuen2017 G
OTOL1     1-0985-003chr3:
162861144-162861144
CTintergenicDe novo--Yuen2017 G
OTOL1     1-0285-003chr3:
161575752-161575752
AGintergenicDe novo--Yuen2017 G
OTOL1     AU3888302chr3:
162844503-162844503
CTintergenicDe novo--Yuen2017 G
OTOL1     1-0232-004chr3:
162335161-162335161
GTintergenicDe novo--Yuen2017 G
OTOL1     AU3051303chr3:
161929209-161929209
CTintergenicDe novo--Yuen2017 G
OTOL1     AU3768302chr3:
162500251-162500251
TCintergenicDe novo--Yuen2017 G
OTOL1     AU4007301chr3:
161873796-161873796
CTintergenicDe novo--Yuen2017 G
OTOL1     AU4159302chr3:
161498830-161498831
ATAintergenicDe novo--Yuen2017 G
OTOL1     2-1357-003chr3:
161611998-161611998
TCintergenicDe novo--Yuen2017 G
OTOL1     7-0148-003chr3:
161664346-161664347
AGAintergenicDe novo--Yuen2017 G
OTOL1     AU3782303chr3:
162435530-162435530
CTintergenicDe novo--Yuen2017 G
OTOL1     1-0991-003chr3:
162330492-162330492
ATintergenicDe novo--Yuen2017 G
OTOL1     2-1120-003chr3:
161779889-161779889
CTintergenicDe novo--Yuen2017 G
OTOL1     13543.p1chr3:
161683388-161683388
CGintergenicDe novo--Turner2016 G
OTOL1     12529.p1chr3:
162334767-162334767
TAintergenicDe novo--Turner2016 G
OTOL1     13393.p1chr3:
161327723-161327723
TAintergenicDe novo--Turner2016 G
OTOL1     2-0289-003chr3:
162456143-162456143
AGintergenicDe novo--Yuen2017 G
OTOL1     1-0512-003chr3:
162331486-162331486
ATintergenicDe novo--Yuen2017 G
OTOL1     A1chr3:
162382020-162382020
GAintergenicDe novo--Wu2018 G
OTOL1     2-1148-004chr3:
162491840-162491840
TTATAACATGAATCAAintergenicDe novo--Yuen2017 G
OTOL1     2-1459-003chr3:
161564403-161564403
GAintergenicDe novo--Yuen2017 G
OTOL1     1-0274-003chr3:
161338618-161338618
GAintergenicDe novo--Yuen2017 G
OTOL1     AU2075302chr3:
162430727-162430727
CAintergenicDe novo--Yuen2017 G
OTOL1     2-0070-003chr3:
161611772-161611772
TCintergenicDe novo--Yuen2017 G
OTOL1     AU028305chr3:
162239089-162239089
TAintergenicDe novo--Yuen2017 G
OTOL1     1-0206-003chr3:
162710772-162710772
GTintergenicDe novo--Yuen2017 G
OTOL1     AU2787301chr3:
161668293-161668293
CAintergenicDe novo--Yuen2017 G
OTOL1     AU4027306chr3:
162807062-162807062
ACintergenicDe novo--Yuen2017 G
OTOL1     AU3806304chr3:
161578958-161578958
CTintergenicDe novo--Yuen2017 G
OTOL1     1-0049-004chr3:
161218345-161218346
AGAintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More