or
or
Exact

Results for "CNTNAP5"

Variant Events: 152

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
CNTNAP5     2-1366-004chr2:
125538214-125538214
CTintronicDe novo--Yuen2017 G
CNTNAP5     13604.p1chr2:
127087750-127087750
GAintergenicDe novo--Werling2018 G
CNTNAP5     1-0282-003chr2:
125472716-125472716
GAintronicDe novo--Yuen2017 G
CNTNAP5     1-0336-003chr2:
126293453-126293453
CTintergenicDe novo--Yuen2017 G
CNTNAP5     AU4235302chr2:
125746234-125746234
GCintergenicDe novo--Yuen2017 G
CNTNAP5     AU3765303chr2:
126232986-126232986
GAintergenicDe novo--Yuen2017 G
CNTNAP5     2-1452-003chr2:
126724783-126724783
TCintergenicDe novo--Yuen2017 G
CNTNAP5     2-0158-003chr2:
126102662-126102662
TCintergenicDe novo--Yuen2017 G
CNTNAP5     AU034904chr2:
127143994-127143994
TCintergenicDe novo--Yuen2017 G
CNTNAP5     AU3680302chr2:
125342536-125342536
GAintronicDe novo--Yuen2017 G
CNTNAP5     AU1988301chr2:
125461186-125461186
CTintronicDe novo--Yuen2017 G
CNTNAP5     12568.p1chr2:
125608083-125608083
TCintronicDe novo--Turner2016 G
CNTNAP5     14482.p1chr2:
127171261-127171261
GAintergenicDe novo--Turner2016 G
CNTNAP5     3-0246-000chr2:
124959863-124959863
ACintronicDe novo--Yuen2016 G
Yuen2017 G
CNTNAP5     AU3808305chr2:
125293789-125293789
AGintronicDe novo--Yuen2017 G
CNTNAP5     5-0095-003chr2:
127275766-127275766
GAintergenicDe novo--Yuen2017 G
CNTNAP5     1-0862-003chr2:
125804910-125804910
TCintergenicDe novo--Yuen2017 G
CNTNAP5     2-1182-003chr2:
126437390-126437390
CTintergenicDe novo--Yuen2016 G
Yuen2017 G
CNTNAP5     1-0901-004chr2:
127162158-127162158
GAintergenicDe novo--Yuen2017 G
CNTNAP5     2-1459-003chr2:
126055140-126055140
GTintergenicDe novo--Yuen2016 G
Yuen2017 G
CNTNAP5     1-0469-003chr2:
125686555-125686556
ACAintergenicDe novo--Yuen2017 G
CNTNAP5     1-0138-003chr2:
125443553-125443553
TCintronicDe novo--Yuen2017 G
CNTNAP5     2-0110-003chr2:
127020358-127020358
GAintergenicDe novo--Yuen2016 G
Yuen2017 G
CNTNAP5     5-0131-003chr2:
126068491-126068506
GGCAACTTTTATGAAAGintergenicDe novo--Yuen2017 G
CNTNAP5     1-0080-003chr2:
124959254-124959254
GAintronicDe novo--Yuen2017 G
CNTNAP5     2-1562-004chr2:
124920612-124920612
TCintronicDe novo--Yuen2017 G
CNTNAP5     AU2793303chr2:
125914898-125914904
ATTTTTTATTTTTTTintergenicDe novo--Yuen2017 G
CNTNAP5     7-0219-003chr2:
127224816-127224816
CTintergenicDe novo--Yuen2017 G
CNTNAP5     1-0289-003chr2:
125447244-125447246
CGTCintronicDe novo--Yuen2017 G
CNTNAP5     AU3874303chr2:
127012009-127012009
TCintergenicDe novo--Yuen2017 G
CNTNAP5     1-0554-003chr2:
126853196-126853196
TGintergenicDe novo--Yuen2017 G
CNTNAP5     1-0554-003chr2:
125338770-125338770
ATintronicDe novo--Yuen2017 G
CNTNAP5     1-0554-003chr2:
125338341-125338341
CTintronicDe novo--Yuen2017 G
CNTNAP5     AU3716302chr2:
126374463-126374463
CTintergenicDe novo--Yuen2017 G
CNTNAP5     AU4032306chr2:
126434923-126434923
TCintergenicDe novo--Yuen2017 G
CNTNAP5     1-0272-004chr2:
125771013-125771013
TTAAATAAAATAintergenicDe novo--Yuen2017 G
CNTNAP5     1-0569-003chr2:
125689153-125689153
GAintergenicDe novo--Yuen2017 G
CNTNAP5     5-0077-004chr2:
126397103-126397103
CAintergenicDe novo--Yuen2017 G
CNTNAP5     AU076705chr2:
124810587-124810587
CTintronicDe novo--Yuen2017 G
CNTNAP5     2-0002-005chr2:
125000702-125000702
TCintronicDe novo--Yuen2017 G
CNTNAP5     AU076705chr2:
124810932-124810932
GCintronicDe novo--Yuen2017 G
CNTNAP5     F2-003chr2:
125669092-125669092
GAexonicPaternalnonsynonymous SNVNM_130773c.G3701Ap.R1234Q11.911.0E-4Vaags2012 E
CNTNAP5     AU0039303chr2:
125418674-125418674
GCintronicDe novo--Yuen2017 G
CNTNAP5     2-1730-003chr2:
125449140-125449140
ACintronicDe novo--Yuen2017 G
CNTNAP5     AU3913302chr2:
126799432-126799432
CTintergenicDe novo--Yuen2017 G
CNTNAP5     2-1114-003chr2:
126478505-126478505
GAintergenicDe novo--Yuen2017 G
CNTNAP5     AU4223302chr2:
125555379-125555379
TCintronicDe novo--Yuen2017 G
CNTNAP5     7-0194-003chr2:
124817331-124817331
GAintronicDe novo--Yuen2017 G
CNTNAP5     AU3912302chr2:
127101878-127101878
AGintergenicDe novo--Yuen2017 G
CNTNAP5     1-0604-003chr2:
126804330-126804339
CTGTGTGTGTCTGTGTGTintergenicDe novo--Yuen2017 G
CNTNAP5     2-1730-003chr2:
126829382-126829382
TAintergenicDe novo--Yuen2017 G
CNTNAP5     1-0604-003chr2:
126258412-126258412
GAintergenicDe novo--Yuen2017 G
CNTNAP5     2-1730-003chr2:
127393887-127393887
GCintergenicDe novo--Yuen2017 G
CNTNAP5     AU2109301chr2:
125302506-125302506
ATintronicDe novo--Yuen2017 G
CNTNAP5     2-1143-003chr2:
125567106-125567106
CAintronicDe novo--Yuen2017 G
CNTNAP5     1-0604-003chr2:
127398408-127398422
CCTCTCTCTCTCTCTCCTCTCTCTCTCTintergenicDe novo--Yuen2017 G
CNTNAP5     AU3052302chr2:
125737268-125737268
AGintergenicDe novo--Yuen2017 G
CNTNAP5     7-0194-003chr2:
124817333-124817333
GAintronicDe novo--Yuen2017 G
CNTNAP5     7-0194-003chr2:
127266718-127266718
CTintergenicDe novo--Yuen2017 G
CNTNAP5     AU3368302chr2:
126368935-126368935
TCintergenicDe novo--Yuen2017 G
CNTNAP5     2-1693-003chr2:
126199466-126199466
TGintergenicDe novo--Yuen2017 G
CNTNAP5     1-0158-003chr2:
125585892-125585913
ACTAAATATAAGAAAAATTAGCAintronicDe novo--Yuen2017 G
CNTNAP5     1-0224-004chr2:
125449390-125449390
TCintronicDe novo--Yuen2017 G
CNTNAP5     AU047904chr2:
127361519-127361519
GCintergenicDe novo--Yuen2017 G
CNTNAP5     5-0014-004chr2:
125158255-125158255
TTGintronicDe novo--Yuen2017 G
CNTNAP5     5-0033-004chr2:
126995189-126995189
GAintergenicDe novo--Yuen2017 G
CNTNAP5     1-0153-004chr2:
127295084-127295085
CACintergenicDe novo--Yuen2017 G
CNTNAP5     2-1174-006chr2:
126851073-126851073
CTintergenicDe novo--Yuen2017 G
CNTNAP5     2-0264-004chr2:
125337026-125337026
TCintronicDe novo--Yuen2017 G
CNTNAP5     2-1105-003chr2:
125844428-125844428
TCintergenicDe novo--Yuen2016 G
Yuen2017 G
CNTNAP5     2-1461-003chr2:
125664532-125664532
CTintronicDe novo--Yuen2016 G
Yuen2017 G
CNTNAP5     1-0252-003chr2:
126447457-126447457
CTintergenicDe novo--Yuen2017 G
CNTNAP5     2-1365-003chr2:
125211388-125211388
CGintronicDe novo--Yuen2016 G
Yuen2017 G
CNTNAP5     AU061003chr2:
127368286-127368286
TGintergenicDe novo--Yuen2017 G
CNTNAP5     AU017703chr2:
124883662-124883662
GCintronicDe novo--Yuen2017 G
CNTNAP5     1-0068-003chr2:
127288011-127288011
CTintergenicDe novo--Yuen2017 G
CNTNAP5     1-0683-004chr2:
125069718-125069718
ATintronicDe novo--Yuen2017 G
CNTNAP5     AU3874301chr2:
125769711-125769711
GAintergenicDe novo--Yuen2017 G
CNTNAP5     AU038703chr2:
127409174-127409174
CTintergenicDe novo--Yuen2017 G
CNTNAP5     1-0448-003chr2:
125403902-125403902
CTintronicDe novo--Yuen2017 G
CNTNAP5     1-0190-003chr2:
124926521-124926521
TCintronicDe novo--Yuen2017 G
CNTNAP5     1-0489-003 Complex Event; expand row to view variants  De novo--Yuen2016 G
Yuen2017 G
CNTNAP5     AU3779302chr2:
126044538-126044538
CTintergenicDe novo--Yuen2017 G
CNTNAP5     2-0320-003chr2:
126931602-126931602
TCintergenicDe novo--Yuen2017 G
CNTNAP5     1-0339-003chr2:
125764099-125764130
GCTGAGAACGGCAGTACGTGTTGCAGGCGGCTGintergenicDe novo--Yuen2017 G
CNTNAP5     AU3918302chr2:
125854127-125854127
AGintergenicDe novo--Yuen2017 G
CNTNAP5     2-1327-004chr2:
127198213-127198213
CTintergenicDe novo--Yuen2017 G
CNTNAP5     AU1952305chr2:
125446080-125446080
GAintronicDe novo--Yuen2017 G
CNTNAP5     AU1952305chr2:
127091743-127091743
CTintergenicDe novo--Yuen2017 G
CNTNAP5     2-0286-004chr2:
125463784-125463784
TGintronicDe novo--Yuen2017 G
CNTNAP5     A7chr2:
126136068-126136068
CTintergenicDe novo--Wu2018 G
CNTNAP5     2-1391-003chr2:
125907994-125907994
CTintergenicDe novo--Yuen2017 G
CNTNAP5     2-0016-003chr2:
127287177-127287177
CTintergenicDe novo--Yuen2017 G
CNTNAP5     AU031003chr2:
124886202-124886202
GAintronicDe novo--Yuen2017 G
CNTNAP5     AU047703chr2:
125533111-125533111
GAintronicDe novo--Yuen2017 G
CNTNAP5     1-0193-003chr2:
126628417-126628417
GAintergenicDe novo--Yuen2017 G
CNTNAP5     2-0318-004chr2:
126751356-126751358
ATTAintergenicDe novo--Yuen2017 G
CNTNAP5     2-1152-003chr2:
125842408-125842408
TAintergenicDe novo--Yuen2016 G
Yuen2017 G
CNTNAP5     AU015903chr2:
125402146-125402149
ATCTATintronicDe novo--Yuen2017 G
CNTNAP5     2-1425-003chr2:
125145583-125145583
CTintronicDe novo--Yuen2017 G
CNTNAP5     2-0006-004chr2:
126442757-126442757
CAintergenicDe novo--Yuen2017 G
CNTNAP5     7-0247-003chr2:
125567587-125567587
AGintronicDe novo--Yuen2017 G
CNTNAP5     AU4263304chr2:
126838222-126838222
ACintergenicDe novo--Yuen2017 G
CNTNAP5     2-1629-003chr2:
125466115-125466115
ATintronicDe novo--Yuen2017 G
CNTNAP5     AU072904chr2:
125333684-125333684
ATintronicDe novo--Yuen2017 G
CNTNAP5     AU072504chr2:
124907710-124907710
GAintronicDe novo--Yuen2017 G
CNTNAP5     1-0197-004chr2:
125967910-125967910
CTintergenicDe novo--Yuen2017 G
CNTNAP5     AU3786301chr2:
126767188-126767188
CTintergenicDe novo--Yuen2017 G
CNTNAP5     5-0077-003chr2:
125907994-125907994
CTintergenicDe novo--Yuen2017 G
CNTNAP5     1-0756-003chr2:
126370716-126370716
GGCCCGGCCintergenicDe novo--Yuen2017 G
CNTNAP5     2-1166-003chr2:
126049990-126049990
CTintergenicDe novo--Yuen2016 G
Yuen2017 G
CNTNAP5     2-1280-003chr2:
126759492-126759492
GAintergenicDe novo--Yuen2016 G
Yuen2017 G
CNTNAP5     5-0077-003chr2:
126397103-126397103
CAintergenicDe novo--Yuen2017 G
CNTNAP5     1-0756-003chr2:
125881342-125881342
GGACCTATGTTAACCTGTGTTACAATTACintergenicDe novo--Yuen2017 G
CNTNAP5     5-0146-003chr2:
125229157-125229157
GTintronicDe novo--Yuen2017 G
CNTNAP5     AU3371305chr2:
127057739-127057750
TTATATATATATTTATATATATATATintergenicDe novo--Yuen2017 G
CNTNAP5     AU3839303chr2:
125225321-125225321
CTintronicDe novo--Yuen2017 G
CNTNAP5     AU050603chr2:
126315360-126315360
TCintergenicDe novo--Yuen2017 G
CNTNAP5     1-0304-003chr2:
126678089-126678089
GTintergenicDe novo--Yuen2016 G
Yuen2017 G
CNTNAP5     2-1290-004chr2:
126656885-126656885
AGintergenicDe novo--Yuen2017 G
CNTNAP5     1-0025-004chr2:
126884717-126884717
GAintergenicDe novo--Yuen2017 G
CNTNAP5     AU2495301chr2:
125733072-125733072
GAintergenicDe novo--Yuen2017 G
CNTNAP5     2-0210-004chr2:
126329706-126329706
CTintergenicDe novo--Yuen2017 G
CNTNAP5     AU4159302chr2:
124881542-124881542
GTintronicDe novo--Yuen2017 G
CNTNAP5     2-0323-003chr2:
124897618-124897618
AAAATCintronicDe novo--Yuen2017 G
CNTNAP5     1507001chr2:
125284870-125284870
GAexonicDe novononsynonymous SNVNM_130773c.G1483Ap.D495N12.793.0E-4Satterstrom2020 E
CNTNAP5     AU2793302chr2:
125253518-125253518
CTintronicDe novo--Yuen2017 G
CNTNAP5     1-0079-008chr2:
124909375-124909375
GAintronicDe novo--Yuen2017 G
CNTNAP5     AU4159302chr2:
126778401-126778401
GCintergenicDe novo--Yuen2017 G
CNTNAP5     AU4306302chr2:
126223667-126223667
AGintergenicDe novo--Yuen2017 G
CNTNAP5     1-0467-005chr2:
125293308-125293308
CTintronicDe novo--Yuen2017 G
CNTNAP5     AU3729301chr2:
126579316-126579316
ACintergenicDe novo--Yuen2017 G
CNTNAP5     AU4069302chr2:
125167162-125167163
AGAintronicDe novo--Yuen2017 G
CNTNAP5     iHART2924chr2:
125547597-125547597
CAexonicMaternalstopgainNM_130773c.C2868Ap.C956X43.0-Ruzzo2019 G
CNTNAP5     AU4314302chr2:
125236681-125236681
TCintronicDe novo--Yuen2017 G
CNTNAP5     74-0115chr2:
125647238-125647238
TCintronicDe novo--Michaelson2012 G
CNTNAP5     AU4219302chr2:
125807511-125807511
AGintergenicDe novo--Yuen2017 G
CNTNAP5     1-0339-004chr2:
125764099-125764130
GCTGAGAACGGCAGTACGTGTTGCAGGCGGCTGintergenicDe novo--Yuen2017 G
CNTNAP5     AU3915301chr2:
126211757-126211757
AGintergenicDe novo--Yuen2017 G
CNTNAP5     1-0169-004chr2:
127089560-127089560
GAintergenicDe novo--Yuen2017 G
CNTNAP5     AU4347301chr2:
127303099-127303099
GTintergenicDe novo--Yuen2017 G
CNTNAP5     AU4433301chr2:
127116874-127116874
TGintergenicDe novo--Yuen2017 G
CNTNAP5     AU3716301chr2:
127136031-127136031
ACintergenicDe novo--Yuen2017 G
CNTNAP5     A13chr2:
125920042-125920042
GAintergenicDe novo--Wu2018 G
CNTNAP5     2-1277-003chr2:
125423649-125423649
GAintronicDe novo--Yuen2017 G
CNTNAP5     2-1526-003chr2:
126822749-126822749
GTintergenicDe novo--Yuen2017 G
CNTNAP5     AU2248302chr2:
127218177-127218177
TCintergenicDe novo--Yuen2017 G
CNTNAP5     AU3907302chr2:
125119612-125119612
GTintronicDe novo--Yuen2017 G
CNTNAP5     AU024607chr2:
124836956-124836956
TCintronicDe novo--Yuen2017 G
CNTNAP5     AU3343301chr2:
126947407-126947407
TCintergenicDe novo--Yuen2017 G
CNTNAP5     1-0464-003chr2:
126660033-126660033
TCintergenicDe novo--Yuen2016 G
Yuen2017 G
CNTNAP5     2-0242-005chr2:
126046756-126046756
GGTintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More