or
or
Exact

Results for "FAM3C"

Variant Events: 29

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
FAM3C     7-0255-003chr7:
121110035-121110035
ACintergenicDe novo--Yuen2017 G
FAM3C     1-0388-003chr7:
121173311-121173312
ACAintergenicDe novo--Yuen2017 G
FAM3C     AU4263304chr7:
121165646-121165646
TCintergenicDe novo--Yuen2017 G
FAM3C     AU2777302chr7:
121172355-121172355
AGintergenicDe novo--Yuen2017 G
FAM3C     1-0665-003chr7:
121084047-121084047
CTintergenicDe novo--Yuen2017 G
FAM3C     AU1308303chr7:
121390872-121390872
CAintergenicDe novo--Yuen2017 G
FAM3C     1-0377-003chr7:
121162615-121162615
AAGTCintergenicDe novo--Yuen2017 G
FAM3C     1-0044-003chr7:
121399454-121399454
GAintergenicDe novo--Yuen2017 G
FAM3C     2-0043-003chr7:
121116635-121116635
ACintergenicDe novo--Yuen2016 G
Yuen2017 G
FAM3C     AU3124302chr7:
121269223-121269223
TCintergenicDe novo--Yuen2017 G
FAM3C     AU058105chr7:
121059460-121059461
CTCintergenicDe novo--Yuen2017 G
FAM3C     AU062204chr7:
121393524-121393524
CAintergenicDe novo--Yuen2017 G
FAM3C     1-0381-003chr7:
121163746-121163769
CTTATTTATTTATTTATTTATTTACTTATTTATTTATTTATTTAintergenicDe novo--Yuen2017 G
FAM3C     5-0004-003chr7:
121434348-121434348
CTintergenicDe novo--Yuen2017 G
FAM3C     10C108727chr7:
121019114-121019114
CAintronicDe novo-8.31E-6Satterstrom2020 E
FAM3C     2-1155-003chr7:
121447375-121447375
GAintergenicDe novo--Yuen2016 G
Yuen2017 G
FAM3C     1-0569-003chr7:
121484823-121484823
GAintergenicDe novo--Yuen2017 G
FAM3C     AU2793301chr7:
121252841-121252841
GAintergenicDe novo--Yuen2017 G
FAM3C     AU1940304chr7:
121397930-121397938
ATAATTAATATAATintergenicDe novo--Yuen2017 G
FAM3C     2-1406-003chr7:
121014500-121014500
TCintronicDe novo--Yuen2016 G
Yuen2017 G
FAM3C     14590.p1chr7:
121189817-121189817
GAintergenicDe novo--Turner2016 G
FAM3C     1-0354-003chr7:
121110921-121110921
AGintergenicDe novo--Yuen2017 G
FAM3C     AU009904chr7:
121340598-121340598
ACintergenicDe novo--Yuen2017 G
FAM3C     1-0213-004chr7:
121291449-121291449
CGintergenicDe novo--Yuen2017 G
FAM3C     2-1366-003chr7:
121065843-121065843
AGintergenicDe novo--Yuen2017 G
FAM3C     AU059903chr7:
121060819-121060837
AAAATAAATAAATAAATAAAAAATAAATAAATAAintergenicDe novo--Yuen2017 G
FAM3C     1-0233-004chr7:
121019114-121019114
CAintronicDe novo-8.31E-6Yuen2017 G
FAM3C     AU4069302chr7:
121086665-121086665
TAintergenicDe novo--Yuen2017 G
FAM3C     5-0017-003chr7:
121123588-121123588
TCintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More