or
or
Exact

Results for "OLFM1"

Variant Events: 13

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
OLFM1     1-0171-005chr9:
137988189-137988189
CCCTCCTTCCCCTCCTTintronicDe novo--Yuen2017 G
OLFM1     2-0149-004chr9:
137988136-137988136
CCCCAintronicDe novo--Yuen2017 G
OLFM1     1-0372-003chr9:
138011670-138011670
CTexonicDe novosynonymous SNVNM_001282611
NM_001282612
NM_014279
c.C1104T
c.C1023T
c.C1050T
p.Y368Y
p.Y341Y
p.Y350Y
-2.0E-4Yuen2016 G
Yuen2017 G
OLFM1     AU4007302chr9:
138059248-138059248
CTintergenicDe novo--Yuen2017 G
OLFM1     1-0253-004chr9:
137988197-137988197
TTCCTCCTCCintronicDe novo--Yuen2017 G
OLFM1     AU4067301chr9:
138005461-138005461
GAintronicDe novo--Yuen2017 G
OLFM1     1-0629-003chr9:
137980016-137980038
GCTCCTCCTCCTCCTCCTCCTCCGCTCCTCCTCCTCCTCCTCCintronicDe novo--Yuen2017 G
OLFM1     10C109030chr9:
138011670-138011670
CTexonicDe novosynonymous SNVNM_001282611
NM_001282612
NM_014279
c.C1104T
c.C1023T
c.C1050T
p.Y368Y
p.Y341Y
p.Y350Y
-2.0E-4Satterstrom2020 E
OLFM1     5-0050-004chr9:
137982207-137982207
TAintronicDe novo--Yuen2017 G
OLFM1     2-0043-003chr9:
137976406-137976406
GCintronicDe novo--Yuen2016 G
Yuen2017 G
OLFM1     5-0110-003chr9:
138038780-138038780
GAintergenicDe novo--Yuen2017 G
OLFM1     2-1086-003chr9:
137983444-137983444
CCACATintronicDe novo--Yuen2017 G
OLFM1     1-0049-004chr9:
137983356-137983356
CCACACACACAGintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More