or
or
Exact

Results for "MIR4465"

Variant Events: 60

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
MIR4465     2-1105-003chr6:
141072928-141072928
TCintergenicDe novo--Yuen2016 G
Yuen2017 G
MIR4465     2-0297-004chr6:
141082178-141082178
ATintergenicDe novo--Yuen2017 G
MIR4465     AU2029301chr6:
141811728-141811728
CGintergenicDe novo--Yuen2017 G
MIR4465     AU043804chr6:
142108213-142108213
GAintergenicDe novo--Yuen2017 G
MIR4465     AU2787301chr6:
141174920-141174920
GCintergenicDe novo--Yuen2017 G
MIR4465     7-0192-003chr6:
142053975-142053975
GTintergenicDe novo--Yuen2017 G
MIR4465     2-1384-003chr6:
142351278-142351278
TCintergenicDe novo--Yuen2017 G
MIR4465     2-0270-004chr6:
141235909-141235909
AATintergenicDe novo--Yuen2017 G
MIR4465     1-0511-003chr6:
141907761-141907788
TAGAGAGAGAGAGATAGAGAGAGAGAGATAGAGAGAGAGATAGAGAGAGAGAGAintergenicDe novo--Yuen2017 G
MIR4465     AU049304chr6:
141426486-141426486
TCintergenicDe novo--Yuen2017 G
MIR4465     2-1525-003chr6:
141295025-141295025
CTintergenicDe novo--Yuen2017 G
MIR4465     2-1348-003chr6:
142317974-142317977
GAAAGAAAAintergenicDe novo--Yuen2017 G
MIR4465     AU3861302chr6:
142292506-142292506
TCintergenicDe novo--Yuen2017 G
MIR4465     AU026604chr6:
142126713-142126713
TCintergenicDe novo--Yuen2017 G
MIR4465     AU3964302chr6:
141311410-141311411
TCTCCAACintergenicDe novo--Yuen2017 G
MIR4465     AU3903302chr6:
141838758-141838758
ATintergenicDe novo--Yuen2017 G
MIR4465     2-1506-003chr6:
141687057-141687057
GAintergenicDe novo--Yuen2017 G
MIR4465     2-0285-003chr6:
141164777-141164777
CGintergenicDe novo--Yuen2017 G
MIR4465     AU4013301chr6:
141024858-141024861
GATAGAintergenicDe novo--Yuen2017 G
MIR4465     AU4233301chr6:
141332663-141332670
TACTCACTTACTintergenicDe novo--Yuen2017 G
MIR4465     2-0033-003chr6:
141415926-141415926
CAintergenicDe novo--Yuen2017 G
MIR4465     2-1352-003chr6:
141893676-141893676
CTintergenicDe novo--Yuen2016 G
Yuen2017 G
MIR4465     AU3984302chr6:
141209780-141209780
ATintergenicDe novo--Yuen2017 G
MIR4465     60-2027chr6:
142134819-142134819
AGintergenicDe novo--Michaelson2012 G
MIR4465     1-0054-004chr6:
141814254-141814254
GAintergenicDe novo--Yuen2017 G
MIR4465     2-0297-003chr6:
142199085-142199085
GAintergenicDe novo--Yuen2017 G
MIR4465     1-0413-003chr6:
141113948-141113948
CGintergenicDe novo--Yuen2017 G
MIR4465     AU005213chr6:
141400598-141400598
TCintergenicDe novo--Yuen2017 G
MIR4465     AU2792302chr6:
141235553-141235554
AGAintergenicDe novo--Yuen2017 G
MIR4465     2-1242-003chr6:
141192827-141192827
GAintergenicDe novo--Yuen2016 G
MIR4465     1-0585-003chr6:
141429910-141429910
CTintergenicDe novo--Yuen2017 G
MIR4465     1-0558-003chr6:
141470050-141470050
GAintergenicDe novo--Yuen2017 G
MIR4465     2-1278-003chr6:
141665611-141665611
TCintergenicDe novo--Yuen2016 G
MIR4465     AU3912303chr6:
142196745-142196745
AGintergenicDe novo--Yuen2017 G
MIR4465     1-0973-003chr6:
142366906-142366906
AGintergenicDe novo--Yuen2017 G
MIR4465     2-1383-003chr6:
142014057-142014063
CAAAAAACAAAAAAAintergenicDe novo--Yuen2017 G
MIR4465     AU079605chr6:
141436113-141436113
TCintergenicDe novo--Yuen2017 G
MIR4465     AU3716302chr6:
141483905-141483909
ATTTTATTTintergenicDe novo--Yuen2017 G
MIR4465     1-0161-004chr6:
141707828-141707828
CTintergenicDe novo--Yuen2017 G
MIR4465     A32chr6:
142386479-142386479
TCintergenicDe novo--Wu2018 G
MIR4465     AU050910chr6:
141705510-141705510
GTintergenicDe novo--Yuen2017 G
MIR4465     AU056804chr6:
141438849-141438854
CATATACATAintergenicDe novo--Yuen2017 G
MIR4465     AU1725306chr6:
141154434-141154434
GAintergenicDe novo--Yuen2017 G
MIR4465     7-0055-003chr6:
142388019-142388019
TCintergenicDe novo--Yuen2017 G
MIR4465     AU2975301chr6:
142254823-142254823
GAintergenicDe novo--Yuen2017 G
MIR4465     AU4013303chr6:
141024858-141024861
GATAGAintergenicDe novo--Yuen2017 G
MIR4465     AU4164301chr6:
142232005-142232005
TCintergenicDe novo--Yuen2017 G
MIR4465     AU4269301chr6:
141854349-141854349
CGintergenicDe novo--Yuen2017 G
MIR4465     1-0219-003chr6:
142122179-142122179
CTintergenicDe novo--Yuen2017 G
MIR4465     1-0453-003chr6:
141667631-141667631
AGintergenicDe novo--Yuen2017 G
MIR4465     AU011604chr6:
141379924-141379927
GCCCGCCintergenicDe novo--Yuen2017 G
MIR4465     2-1497-003chr6:
141616015-141616015
CTintergenicDe novo--Yuen2017 G
MIR4465     1-0486-003chr6:
141126936-141126936
TCintergenicDe novo--Yuen2017 G
MIR4465     AU3891303chr6:
141597011-141597011
ACintergenicDe novo--Yuen2017 G
MIR4465     1-0244-003chr6:
142268718-142268718
ATintergenicDe novo--Yuen2016 G
Yuen2017 G
MIR4465     2-1154-003chr6:
141763315-141763315
TGintergenicDe novo--Yuen2016 G
Yuen2017 G
MIR4465     AU3727302chr6:
142286447-142286447
AGintergenicDe novo--Yuen2017 G
MIR4465     2-1153-003chr6:
141975516-141975516
TCintergenicDe novo--Yuen2016 G
Yuen2017 G
MIR4465     AU0452304chr6:
141361329-141361329
AGintergenicDe novo--Yuen2017 G
MIR4465     1-0092-004chr6:
141180322-141180322
CTintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More