or
or
Exact

Results for "LINC00901"

Variant Events: 107

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
LINC00901     2-0142-004chr3:
117701578-117701578
GAintergenicDe novo--Yuen2017 G
LINC00901     1-0597-003chr3:
116856967-116856967
TTTCintergenicDe novo--Yuen2017 G
LINC00901     AU4379301chr3:
117288855-117288855
TCintergenicDe novo--Yuen2017 G
LINC00901     7-0143-003chr3:
117734061-117734061
TCintergenicDe novo--Yuen2017 G
LINC00901     1-0914-003chr3:
118342614-118342614
CTintergenicDe novo--Yuen2017 G
LINC00901     AU2108302chr3:
118024481-118024481
TTAintergenicDe novo--Yuen2017 G
LINC00901     2-0043-003chr3:
116836466-116836466
CTintergenicDe novo--Yuen2016 G
Yuen2017 G
LINC00901     AU2139301chr3:
118298785-118298785
TGintergenicDe novo--Yuen2017 G
LINC00901     5-0014-003chr3:
118029145-118029145
TCintergenicDe novo--Yuen2017 G
LINC00901     AU1355301chr3:
118567733-118567733
CTintergenicDe novo--Yuen2017 G
LINC00901     2-1358-003chr3:
117752197-117752197
TCintergenicDe novo--Yuen2017 G
LINC00901     2-0309-004chr3:
118568099-118568099
ATintergenicDe novo--Yuen2017 G
LINC00901     1-0075-003chr3:
117663811-117663811
GTintergenicDe novo--Yuen2017 G
LINC00901     AU3903302chr3:
117248699-117248699
CTintergenicDe novo--Yuen2017 G
LINC00901     5-0147-003chr3:
117651946-117651946
GTintergenicDe novo--Yuen2017 G
LINC00901     5-0025-003chr3:
118150717-118150727
TTTTAAAATAGTintergenicDe novo--Yuen2017 G
LINC00901     1-0671-003chr3:
117896801-117896801
TTCCCCTTTACintergenicDe novo--Yuen2017 G
LINC00901     3-0438-000chr3:
117838610-117838610
TCintergenicDe novo--Yuen2016 G
LINC00901     2-1182-003chr3:
118541867-118541867
GTintergenicDe novo--Yuen2016 G
Yuen2017 G
LINC00901     1-0125-003chr3:
118249205-118249208
GTCTGintergenicDe novo--Yuen2017 G
LINC00901     AU2495302chr3:
117837513-117837513
TCintergenicDe novo--Yuen2017 G
LINC00901     14015.p1chr3:
117072270-117072270
GAintergenicDe novo--Turner2016 G
LINC00901     13946.p1chr3:
117109285-117109285
TCintergenicDe novo--Turner2016 G
LINC00901     1-0323-003chr3:
117626668-117626668
CTintergenicDe novo--Yuen2017 G
LINC00901     2-1279-003chr3:
117437228-117437228
CTintergenicDe novo--Yuen2016 G
Yuen2017 G
LINC00901     12493.p1chr3:
118078466-118078466
GCintergenicDe novo--Turner2016 G
LINC00901     1-0534-006chr3:
118339091-118339091
TGintergenicDe novo--Yuen2017 G
LINC00901     2-1455-003chr3:
117801434-117801434
CTintergenicDe novo--Yuen2016 G
Yuen2017 G
LINC00901     1-0636-003chr3:
117475246-117475258
AACACACACACACAACACACACACintergenicDe novo--Yuen2017 G
LINC00901     2-1170-003chr3:
118224377-118224380
CCTTCintergenicDe novo--Yuen2017 G
LINC00901     2-1430-003chr3:
117993198-117993198
CTintergenicDe novo--Yuen2016 G
Yuen2017 G
LINC00901     2-1152-003chr3:
118312452-118312452
GAintergenicDe novo--Yuen2016 G
LINC00901     2-1212-003chr3:
118425148-118425148
CTintergenicDe novo--Yuen2017 G
LINC00901     1-0186-005chr3:
117736267-117736270
GTATGintergenicDe novo--Yuen2017 G
LINC00901     74-0117chr3:
118263794-118263794
ATintergenicInherited--Michaelson2012 G
LINC00901     AU2292301chr3:
118317633-118317633
TCintergenicDe novo--Yuen2017 G
LINC00901     AU3866301chr3:
116650936-116650949
GTTATTATTATTATGTTATTATTATncRNA_exonicDe novo--Yuen2017 G
LINC00901     AU3371302chr3:
117117342-117117342
GTintergenicDe novo--Yuen2017 G
LINC00901     2-1617-003chr3:
116726898-116726899
TATintergenicDe novo--Yuen2017 G
LINC00901     3-0456-000Bchr3:
116853991-116853991
AGintergenicDe novo--Yuen2017 G
LINC00901     AU1725302chr3:
116994832-116994832
CAintergenicDe novo--Yuen2017 G
LINC00901     2-1245-003chr3:
117278672-117278672
GAintergenicDe novo--Yuen2017 G
LINC00901     2-1235-004chr3:
117441285-117441285
GAintergenicDe novo--Yuen2017 G
LINC00901     2-1362-003chr3:
118198117-118198117
GAintergenicDe novo--Yuen2017 G
LINC00901     AU3768302chr3:
117960846-117960846
TCintergenicDe novo--Yuen2017 G
LINC00901     2-1380-003chr3:
117844537-117844537
TCintergenicDe novo--Yuen2016 G
Yuen2017 G
LINC00901     A1chr3:
118334460-118334460
GGGintergenicDe novo--Wu2018 G
LINC00901     AU072005chr3:
118180025-118180025
CGintergenicDe novo--Yuen2017 G
LINC00901     2-0242-003chr3:
117515849-117515849
CTintergenicDe novo--Yuen2017 G
LINC00901     1-0401-003chr3:
117759779-117759779
CGintergenicDe novo--Yuen2017 G
LINC00901     2-1258-003chr3:
117499308-117499309
ATAintergenicDe novo--Yuen2017 G
LINC00901     2-1341-003chr3:
116993900-116993900
GTintergenicDe novo--Yuen2017 G
LINC00901     2-1526-004chr3:
116988567-116988567
AGintergenicDe novo--Yuen2017 G
LINC00901     AU4159301chr3:
116853609-116853609
CAintergenicDe novo--Yuen2017 G
LINC00901     2-1223-003chr3:
116816704-116816704
CAintergenicDe novo--Yuen2017 G
LINC00901     7-0242-003chr3:
118268333-118268333
CTintergenicDe novo--Yuen2017 G
LINC00901     2-0006-003chr3:
116690783-116690783
AGintergenicDe novo--Yuen2017 G
LINC00901     AU006804chr3:
116989731-116989731
TAintergenicDe novo--Yuen2017 G
LINC00901     AU054103chr3:
118377756-118377756
CTintergenicDe novo--Yuen2017 G
LINC00901     2-0202-003chr3:
116780200-116780200
AGintergenicDe novo--Yuen2017 G
LINC00901     1-0329-003chr3:
117559201-117559201
TCintergenicDe novo--Yuen2017 G
LINC00901     AU076509chr3:
117680398-117680398
ACintergenicDe novo--Yuen2017 G
LINC00901     2-0102-004chr3:
118604338-118604338
CTintergenicDe novo--Yuen2017 G
LINC00901     AU2292302chr3:
117057022-117057022
ATintergenicDe novo--Yuen2017 G
LINC00901     AU3794302chr3:
117700939-117700946
GTATATATGTATATintergenicDe novo--Yuen2017 G
LINC00901     1-0572-003chr3:
116889779-116889779
TCintergenicDe novo--Yuen2017 G
LINC00901     AU2292302chr3:
118317633-118317633
TCintergenicDe novo--Yuen2017 G
LINC00901     AU3057301chr3:
118545391-118545393
GAAGAAAAintergenicDe novo--Yuen2017 G
LINC00901     2-1155-003chr3:
117596444-117596444
GTintergenicDe novo--Yuen2016 G
Yuen2017 G
LINC00901     2-1709-003chr3:
116843676-116843676
CTintergenicDe novo--Yuen2017 G
LINC00901     1-0079-003chr3:
118196829-118196829
CAintergenicDe novo--Yuen2017 G
LINC00901     AU3730301chr3:
118149389-118149389
AGintergenicDe novo--Yuen2017 G
LINC00901     7-0179-003chr3:
118538786-118538799
GTATATATATATATGTATATATATATintergenicDe novo--Yuen2017 G
LINC00901     3-0396-000chr3:
117580263-117580263
CTintergenicDe novo--Yuen2016 G
LINC00901     1-0638-003chr3:
118459071-118459086
TACACACACACACACATACACACACACACAintergenicDe novo--Yuen2017 G
LINC00901     2-0132-004chr3:
116779450-116779450
CAintergenicDe novo--Yuen2017 G
LINC00901     1-0339-003chr3:
116972087-116972087
TCintergenicDe novo--Yuen2017 G
LINC00901     2-1709-003chr3:
118123494-118123494
GAintergenicDe novo--Yuen2017 G
LINC00901     1-0273-004chr3:
118484549-118484549
AGintergenicDe novo--Yuen2017 G
LINC00901     1-0706-003chr3:
116821030-116821030
ATintergenicDe novo--Yuen2017 G
LINC00901     2-1137-003chr3:
116935756-116935756
TCintergenicDe novo--Yuen2016 G
Yuen2017 G
LINC00901     2-1460-003chr3:
116900257-116900257
CTintergenicDe novo--Yuen2017 G
LINC00901     2-1094-005chr3:
117897453-117897453
TCintergenicDe novo--Yuen2017 G
LINC00901     2-1731-003chr3:
117049013-117049013
ATintergenicDe novo--Yuen2017 G
LINC00901     AU4168306chr3:
116817645-116817645
AGintergenicDe novo--Yuen2017 G
LINC00901     1-0490-003chr3:
117269898-117269898
GAintergenicDe novo--Yuen2017 G
LINC00901     2-1382-003chr3:
117217977-117217977
CGintergenicDe novo--Yuen2016 G
Yuen2017 G
LINC00901     2-1689-003chr3:
118458232-118458232
TGintergenicDe novo--Yuen2017 G
LINC00901     AU2293301chr3:
116707012-116707012
ATintergenicDe novo--Yuen2017 G
LINC00901     2-0310-003chr3:
117187963-117187970
CATCCAGACintergenicDe novo--Yuen2017 G
LINC00901     3-0391-000chr3:
116962409-116962409
AGintergenicDe novo--Yuen2017 G
LINC00901     AU4013303chr3:
118259082-118259082
CTintergenicDe novo--Yuen2017 G
LINC00901     2-1254-003chr3:
117130542-117130542
TAintergenicDe novo--Yuen2016 G
LINC00901     7-0253-005chr3:
118095011-118095011
GAintergenicDe novo--Yuen2017 G
LINC00901     A29chr3:
116961566-116961566
CTintergenicDe novo--Wu2018 G
LINC00901     1-0126-004chr3:
118165702-118165702
GCintergenicDe novo--Yuen2017 G
LINC00901     7-0103-003chr3:
117504249-117504249
CGintergenicDe novo--Yuen2017 G
LINC00901     2-1497-003chr3:
116646169-116646169
GCncRNA_intronicDe novo--Yuen2017 G
LINC00901     1-0079-008chr3:
118609623-118609623
AGintergenicDe novo--Yuen2017 G
LINC00901     1-0079-008chr3:
118015522-118015522
CTintergenicDe novo--Yuen2017 G
LINC00901     2-1267-003chr3:
118012525-118012525
ATintergenicDe novo--Yuen2017 G
LINC00901     AU0786305chr3:
118439465-118439465
TCintergenicDe novo--Yuen2017 G
LINC00901     2-0144-004chr3:
118595043-118595043
TCintergenicDe novo--Yuen2017 G
LINC00901     AU3997302chr3:
116769670-116769670
GAintergenicDe novo--Yuen2017 G
LINC00901     1-0041-003chr3:
117276312-117276312
TAintergenicDe novo--Yuen2016 G
Yuen2017 G
LINC00901     1-0541-003chr3:
116921704-116921708
CCAAACintergenicDe novo--Yuen2017 G
LINC00901     AU4496301chr3:
118169838-118169838
GAintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More