or
or
Exact

Results for "MIR3681HG"

Variant Events: 40

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
MIR3681HG     AU079204chr2:
12333903-12333903
GAncRNA_intronicDe novo--Yuen2017 G
MIR3681HG     AU4186302chr2:
12666755-12666755
GTncRNA_intronicDe novo--Yuen2017 G
MIR3681HG     13539.p1chr2:
12564348-12564348
GAncRNA_intronicDe novo--Turner2016 G
MIR3681HG     2-1142-003chr2:
12827032-12827032
CTintergenicDe novo--Yuen2017 G
MIR3681HG     13951.p1chr2:
12570843-12570843
TCncRNA_intronicDe novo--Turner2016 G
MIR3681HG     1-0417-003chr2:
12224542-12224542
TCncRNA_intronicDe novo--Yuen2016 G
Yuen2017 G
MIR3681HG     1-0041-003chr2:
12400293-12400293
TCncRNA_intronicDe novo--Yuen2017 G
MIR3681HG     1-0458-005chr2:
12320386-12320386
AGncRNA_intronicDe novo--Yuen2017 G
MIR3681HG     2-1302-003chr2:
12571495-12571495
CTncRNA_intronicDe novo--Yuen2017 G
MIR3681HG     1-0303-003chr2:
12538235-12538235
CTncRNA_intronicDe novo--Yuen2017 G
MIR3681HG     2-0296-004chr2:
12298814-12298814
CTncRNA_intronicDe novo--Yuen2017 G
MIR3681HG     2-1460-003chr2:
12260467-12260467
CTncRNA_intronicDe novo--Yuen2017 G
MIR3681HG     1-0385-003chr2:
12359594-12359609
CAGAGAGAGAGAGAGACAGAGAGAGAGAGAncRNA_intronicDe novo--Yuen2017 G
MIR3681HG     1-0231-004chr2:
12852276-12852276
CGintergenicDe novo--Yuen2017 G
MIR3681HG     2-1382-003chr2:
12238052-12238052
TCncRNA_intronicDe novo--Yuen2016 G
Yuen2017 G
MIR3681HG     2-1526-004chr2:
12556084-12556084
GCncRNA_intronicDe novo--Yuen2017 G
MIR3681HG     1-0054-004chr2:
12416663-12416663
CCAncRNA_intronicDe novo--Yuen2017 G
MIR3681HG     2-1402-003chr2:
12790712-12790712
AGintergenicDe novo--Yuen2017 G
MIR3681HG     3-0442-000chr2:
12399675-12399675
GAncRNA_intronicDe novo--Yuen2016 G
Yuen2017 G
MIR3681HG     2-1194-003chr2:
12512895-12512895
CGncRNA_intronicDe novo--Yuen2016 G
Yuen2017 G
MIR3681HG     5-0131-003chr2:
12589855-12589855
TAncRNA_intronicDe novo--Yuen2017 G
MIR3681HG     1-0019-004chr2:
12151537-12151537
TCncRNA_intronicDe novo--Yuen2017 G
MIR3681HG     AU4314302chr2:
12384691-12384691
CGncRNA_intronicDe novo--Yuen2017 G
MIR3681HG     2-1116-003chr2:
12202841-12202841
AGncRNA_intronicDe novo--Yuen2016 G
Yuen2017 G
MIR3681HG     AU031403chr2:
12440663-12440663
CGncRNA_intronicDe novo--Yuen2017 G
MIR3681HG     AU4033303chr2:
12222384-12222384
TAncRNA_intronicDe novo--Yuen2017 G
MIR3681HG     1-0044-003chr2:
12440464-12440464
CTncRNA_intronicDe novo--Yuen2017 G
MIR3681HG     AU043804chr2:
12551227-12551227
ATncRNA_intronicDe novo--Yuen2017 G
MIR3681HG     A7chr2:
12184070-12184070
GAncRNA_intronicDe novo--Wu2018 G
MIR3681HG     1-0906-003chr2:
12738585-12738585
GCintergenicDe novo--Yuen2017 G
MIR3681HG     2-1105-003chr2:
12531812-12531812
CTncRNA_intronicDe novo--Yuen2016 G
Yuen2017 G
MIR3681HG     5-0015-004chr2:
12802029-12802029
CTintergenicDe novo--Yuen2017 G
MIR3681HG     2-0295-003chr2:
12782209-12782209
TTTATAGAGTCATGAAGACAGACCAGTGAintergenicDe novo--Yuen2017 G
MIR3681HG     AU3839302chr2:
12789316-12789316
ACintergenicDe novo--Yuen2017 G
MIR3681HG     2-1431-003chr2:
12423202-12423216
GCACACACACACACAGCACACACACACAncRNA_intronicDe novo--Yuen2017 G
MIR3681HG     AU3905301chr2:
12675424-12675424
GAncRNA_intronicDe novo--Yuen2017 G
MIR3681HG     A17chr2:
12251831-12251831
ACncRNA_intronicDe novo--Wu2018 G
MIR3681HG     AU2139303chr2:
12776004-12776004
ATintergenicDe novo--Yuen2017 G
MIR3681HG     AU024607chr2:
12497752-12497752
GAncRNA_intronicDe novo--Yuen2017 G
MIR3681HG     1-0261-004chr2:
12726591-12726591
CTintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More