or
or
Exact

Results for "MIR3660"

Variant Events: 57

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
MIR3660     2-1089-004chr5:
88454784-88454784
CCTGAGAintergenicDe novo--Yuen2017 G
MIR3660     AU1795302chr5:
88574059-88574066
CCTCTCTCCCTCTCintergenicDe novo--Yuen2017 G
MIR3660     2-1330-003chr5:
88946516-88946529
AACACACACACACAAACACACACACAintergenicDe novo--Yuen2017 G
MIR3660     AU2000304chr5:
88393897-88393897
GAintergenicDe novo--Yuen2017 G
MIR3660     2-0043-003chr5:
88696204-88696204
CTintergenicDe novo--Yuen2016 G
Yuen2017 G
MIR3660     1-0914-003chr5:
88872086-88872086
GAintergenicDe novo--Yuen2017 G
MIR3660     2-0242-005chr5:
88511174-88511174
TCintergenicDe novo--Yuen2017 G
MIR3660     AU3874301chr5:
88441037-88441037
AGintergenicDe novo--Yuen2017 G
MIR3660     1-0965-003chr5:
88553287-88553287
CTintergenicDe novo--Yuen2017 G
MIR3660     AU3713302chr5:
89339284-89339284
CTintergenicDe novo--Yuen2017 G
MIR3660     AU2108302chr5:
88796014-88796014
TCintergenicDe novo--Yuen2017 G
MIR3660     AU018010chr5:
89223512-89223518
GATATATGATintergenicDe novo--Yuen2017 G
MIR3660     AU4197301chr5:
88840442-88840442
TCintergenicDe novo--Yuen2017 G
MIR3660     1-0382-004chr5:
88870996-88870996
TCintergenicDe novo--Yuen2017 G
MIR3660     AU2108302chr5:
88563816-88563816
CTintergenicDe novo--Yuen2017 G
MIR3660     AU2569303chr5:
89260952-89260952
ACintergenicDe novo--Yuen2017 G
MIR3660     5-0084-003chr5:
89216386-89216386
CTintergenicDe novo--Yuen2017 G
MIR3660     2-1645-003chr5:
88805134-88805134
GCintergenicDe novo--Yuen2017 G
MIR3660     AU3891302chr5:
88438227-88438227
CTintergenicDe novo--Yuen2017 G
MIR3660     7-0059-003chr5:
88567131-88567131
AGintergenicDe novo--Yuen2017 G
MIR3660     7-0100-003chr5:
88401496-88401496
GAintergenicDe novo--Yuen2017 G
MIR3660     1-0595-005chr5:
89043014-89043014
GTintergenicDe novo--Yuen2017 G
MIR3660     2-0033-003chr5:
88869002-88869017
CATATATATATATATACATATATATATATAintergenicDe novo--Yuen2017 G
MIR3660     2-1261-004chr5:
89437364-89437364
GAintergenicDe novo--Yuen2017 G
MIR3660     2-1333-003chr5:
89430277-89430277
CTintergenicDe novo--Yuen2017 G
MIR3660     2-0033-003chr5:
88636489-88636489
TAintergenicDe novo--Yuen2017 G
MIR3660     2-1089-003chr5:
88454784-88454784
CCTGAGAintergenicDe novo--Yuen2017 G
MIR3660     2-1731-003chr5:
88806491-88806491
GAintergenicDe novo--Yuen2017 G
MIR3660     1-0585-003chr5:
88830870-88830870
AGintergenicDe novo--Yuen2017 G
MIR3660     2-1508-004chr5:
89308812-89308812
ACintergenicDe novo--Yuen2017 G
MIR3660     13658.p1chr5:
89326108-89326108
GAintergenicDe novo--Wilfert2021 G
MIR3660     AU1795303chr5:
88438357-88438357
TCintergenicDe novo--Yuen2017 G
MIR3660     1-0099-003chr5:
89210107-89210107
TCintergenicDe novo--Yuen2017 G
MIR3660     AU4183301chr5:
89288993-89288993
CTintergenicDe novo--Yuen2017 G
MIR3660     11729.p1chr5:
88475510-88475510
GCintergenicDe novo--Wilfert2021 G
MIR3660     2-1163-003chr5:
89361223-89361223
CTintergenicDe novo--Yuen2017 G
MIR3660     AU3900302chr5:
88873035-88873035
CTintergenicDe novo--Yuen2017 G
MIR3660     1-0206-004chr5:
88559478-88559478
CTintergenicDe novo--Yuen2017 G
MIR3660     1-0175-004chr5:
89043618-89043618
TTTAintergenicDe novo--Yuen2017 G
MIR3660     2-1210-003chr5:
88829259-88829259
GAintergenicDe novo--Yuen2017 G
MIR3660     2-1451-004chr5:
88643245-88643245
AGintergenicDe novo--Yuen2017 G
MIR3660     1-0175-004chr5:
89199981-89199981
TCintergenicDe novo--Yuen2017 G
MIR3660     1-0446-003chr5:
88361331-88361331
AATAATCintergenicDe novo--Yuen2017 G
MIR3660     1-0344-003chr5:
89079126-89079126
AGintergenicDe novo--Yuen2017 G
MIR3660     AU011604chr5:
88525188-88525188
GAintergenicDe novo--Yuen2017 G
MIR3660     AU4394302chr5:
89183312-89183312
TAintergenicDe novo--Yuen2017 G
MIR3660     1-0120-003chr5:
88446693-88446693
GCintergenicDe novo--Yuen2017 G
MIR3660     2-1720-003chr5:
89003691-89003691
CTintergenicDe novo--Yuen2017 G
MIR3660     A23chr5:
88494771-88494771
AGintergenicDe novo--Wu2018 G
MIR3660     2-0296-004chr5:
88729327-88729327
GAintergenicDe novo--Yuen2017 G
MIR3660     1-0991-003chr5:
88888992-88888992
GTintergenicDe novo--Yuen2017 G
MIR3660     2-0309-005chr5:
88685294-88685294
AGintergenicDe novo--Yuen2017 G
MIR3660     7-0140-003chr5:
88776697-88776697
AGintergenicDe novo--Yuen2017 G
MIR3660     1-0175-003chr5:
89199981-89199981
TCintergenicDe novo--Yuen2017 G
MIR3660     1-0175-003chr5:
89043618-89043618
TTTAintergenicDe novo--Yuen2017 G
MIR3660     5-0045-003chr5:
88513061-88513061
CTintergenicDe novo--Yuen2017 G
MIR3660     1-0445-003chr5:
89267065-89267065
GCintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More