or
or
Exact

Results for "CDH4"

Variant Events: 103

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
CDH4     13324.p1chr20:
60377505-60377505
GTintronicDe novo--Turner2016 G
CDH4     2-1283-004chr20:
59906745-59906745
CAintronicDe novo--Yuen2017 G
CDH4     A8chr20:
60442936-60442936
AGintronicDe novo--Wu2018 G
CDH4     AU3765302chr20:
60311861-60311861
CTintronicDe novo--Yuen2017 G
CDH4     1-0299-003chr20:
59906634-59906634
CAintronicDe novo--Yuen2017 G
CDH4     AU2569301chr20:
60322269-60322269
GAintronicDe novo--Yuen2017 G
CDH4     1-0161-004chr20:
59906745-59906745
CAintronicDe novo--Yuen2017 G
CDH4     1-0158-012chr20:
59906686-59906686
GGACCCGACCACCTCintronicDe novo--Yuen2017 G
CDH4     2-1261-003chr20:
59912378-59912378
AACAGintronicDe novo--Yuen2017 G
CDH4     1-0632-003chr20:
59912392-59912392
GGATCATAintronicDe novo--Yuen2017 G
CDH4     1-0161-004chr20:
60353068-60353068
TTCCACATGCintronicDe novo--Yuen2017 G
CDH4     1-0632-003chr20:
59906634-59906634
CAintronicDe novo--Yuen2017 G
CDH4     AU2381302chr20:
60097137-60097137
GTintronicDe novo--Yuen2017 G
CDH4     2-1261-003chr20:
60080678-60080678
AGintronicDe novo--Yuen2017 G
CDH4     2-1505-003chr20:
60316100-60316100
AGintronicDe novo--Yuen2017 G
CDH4     2-0202-004chr20:
60370167-60370167
GGTGAintronicDe novo--Yuen2017 G
CDH4     11074.p1chr20:
60485668-60485668
GAintronicMosaic, De novo-6.695E-5Dou2017 E
Krumm2015 E
CDH4     11316.p1chr20:
60148128-60148134
AGATGGTGGAintronicDe novo--Krumm2015 E
CDH4     AU3716301chr20:
60129443-60129443
GAintronicDe novo--Yuen2017 G
CDH4     2-1290-004chr20:
59906634-59906634
CAintronicDe novo--Yuen2017 G
CDH4     5-0015-003chr20:
60370191-60370191
AATGGintronicDe novo--Yuen2017 G
CDH4     1-0339-004chr20:
60399189-60399189
CGintronicDe novo--Yuen2017 G
CDH4     12894.p1chr20:
59904350-59904350
GCintronicMosaic Pat.--Dou2017 E
CDH4     1-0051-005chr20:
60370133-60370133
GGTAintronicDe novo--Yuen2017 G
CDH4     2-0045-003chr20:
59867546-59867546
ACintronicDe novo--Yuen2016 G
Yuen2017 G
CDH4     AU4219302chr20:
60334147-60334147
CTintronicDe novo--Yuen2017 G
CDH4     1-0206-003chr20:
59906714-59906714
CAintronicDe novo--Yuen2017 G
CDH4     1-0402-004chr20:
60370178-60370178
GGGTGATGGTAintronicDe novo--Yuen2017 G
CDH4     13221.p1chr20:
59904412-59904412
GAintronicMosaic--Dou2017 E
CDH4     2-1176-003chr20:
59906729-59906729
CTintronicDe novo--Yuen2017 G
CDH4     7-0095-004chr20:
59906690-59906690
CCGGCCACCTGCCCTintronicDe novo--Yuen2017 G
CDH4     1-0484-003chr20:
59906634-59906634
CAintronicDe novo--Yuen2017 G
CDH4     5-0017-004chr20:
59906640-59906640
CTintronicDe novo--Yuen2017 G
CDH4     5-0017-004chr20:
60370191-60370191
AATGGintronicDe novo--Yuen2017 G
CDH4     AU1223301chr20:
60428658-60428658
CTintronicDe novo--Yuen2017 G
CDH4     2-1339-003chr20:
59906634-59906634
CAintronicDe novo--Yuen2017 G
CDH4     1-0551-004chr20:
59906727-59906727
CCACCTCCTGCCCCAGCCACCTGCCTCAGATCTintronicDe novo--Yuen2017 G
CDH4     5-0014-003chr20:
59906634-59906634
CAintronicDe novo--Yuen2017 G
CDH4     1-0261-004chr20:
59906638-59906638
CTintronicDe novo--Yuen2017 G
CDH4     2-0215-003chr20:
60370187-60370187
GGATGGTintronicDe novo--Yuen2017 G
CDH4     1-0248-003chr20:
60481985-60481985
CTintronicDe novo--Yuen2017 G
CDH4     1-0495-003chr20:
59906014-59906014
ACintronicDe novo--Yuen2017 G
CDH4     1-0563-004chr20:
59906682-59906682
TTCCTGACCAAGCCAintronicDe novo--Yuen2017 G
CDH4     AU049304chr20:
60079761-60079761
CTintronicDe novo--Yuen2017 G
CDH4     2-0068-003chr20:
60455833-60455833
GAintronicDe novo--Yuen2017 G
CDH4     1-0323-003chr20:
59906665-59906665
CAintronicDe novo--Yuen2017 G
CDH4     1-0186-005chr20:
60398352-60398352
AGintronicDe novo--Yuen2017 G
CDH4     2-0007-004chr20:
59906640-59906640
CTintronicDe novo--Yuen2017 G
CDH4     7-0082-003chr20:
59906745-59906745
CAintronicDe novo--Yuen2017 G
CDH4     1-0466-003chr20:
60379296-60379296
GTintronicDe novo--Yuen2017 G
CDH4     AU1795303chr20:
60093454-60093454
GCintronicDe novo--Yuen2017 G
CDH4     2-1362-003chr20:
60343519-60343519
CTintronicDe novo--Yuen2017 G
CDH4     1-0935-003chr20:
60495974-60495980
CGTGGTGCGTGintronicDe novo--Yuen2017 G
CDH4     2-0149-004chr20:
60370191-60370191
AATGGintronicDe novo--Yuen2017 G
CDH4     AU4029301chr20:
60446074-60446074
AGintronicDe novo--Yuen2017 G
CDH4     1-0565-004chr20:
59853930-59853930
TCintronicDe novo--Yuen2017 G
CDH4     1-0359-003chr20:
60445410-60445410
GAintronicDe novo--Yuen2017 G
CDH4     2-0278-003chr20:
60464792-60464812
TGATGGATGGATGGATGGATGTGATGGATGGATGGATGintronicDe novo--Yuen2017 G
CDH4     1-0305-004chr20:
59906727-59906727
CCAGATCTintronicDe novo--Yuen2017 G
CDH4     1-0401-003chr20:
60370134-60370134
GGGAintronicDe novo--Yuen2017 G
CDH4     AU4145303chr20:
60169981-60170004
CTTCATTCATTCATTCATTCATTCCTTCATTCATTCATTCATTCATTCATTCintronicDe novo--Yuen2017 G
CDH4     1-0414-005chr20:
60370191-60370191
AATGGintronicDe novo--Yuen2017 G
CDH4     1-0918-003chr20:
60036642-60036642
CTintronicDe novo--Yuen2017 G
CDH4     2-1085-003chr20:
60440954-60440954
GTintronicDe novo--Yuen2017 G
CDH4     1-0022-004chr20:
59949618-59949618
GAintronicDe novo--Yuen2017 G
CDH4     2-1382-003chr20:
60220359-60220359
ACintronicDe novo--Yuen2016 G
Yuen2017 G
CDH4     1-0175-004chr20:
59906634-59906634
CAintronicDe novo--Yuen2017 G
CDH4     1-0051-004chr20:
59906665-59906665
CAintronicDe novo--Yuen2017 G
CDH4     1-0526-003chr20:
60250170-60250170
CTintronicDe novo--Yuen2017 G
CDH4     2-0219-004chr20:
60260344-60260344
CAintronicDe novo--Yuen2017 G
CDH4     AU3398301chr20:
60412227-60412227
CTintronicDe novo--Yuen2017 G
CDH4     1-0552-003chr20:
60206299-60206299
GCintronicDe novo--Yuen2017 G
CDH4     1-0052-004chr20:
60162943-60162943
CAintronicDe novo--Yuen2017 G
CDH4     1-0218-004chr20:
60499957-60499957
TTCintronicDe novo--Yuen2017 G
CDH4     AU2035302chr20:
60495843-60495846
GGTAGintronicDe novo--Yuen2017 G
CDH4     1-0406-003chr20:
60370173-60370173
AATGATGGTAGintronicDe novo--Yuen2017 G
CDH4     5-0018-003chr20:
60370191-60370191
AATGGintronicDe novo--Yuen2017 G
CDH4     1-0252-003chr20:
60105563-60105563
TCintronicDe novo--Yuen2017 G
CDH4     2-1406-003chr20:
60251290-60251290
CTintronicDe novo--Yuen2016 G
Yuen2017 G
CDH4     2-1290-003chr20:
59912378-59912378
AACAGintronicDe novo--Yuen2017 G
CDH4     1-0481-003chr20:
59906682-59906682
TTCCTGACCAAGCCAintronicDe novo--Yuen2017 G
CDH4     2-0088-003chr20:
59906736-59906736
CAintronicDe novo--Yuen2017 G
CDH4     7-0256-003chr20:
59882526-59882526
CTintronicDe novo--Yuen2017 G
CDH4     1-0344-003chr20:
60473263-60473263
GAintronicDe novo--Yuen2017 G
CDH4     5-0033-004chr20:
59906634-59906634
CAintronicDe novo--Yuen2017 G
CDH4     1-0059-003chr20:
60352677-60352677
TTCCACATGCGCACACACAGintronicDe novo--Yuen2017 G
CDH4     2-1719-003chr20:
60025798-60025798
GAintronicDe novo--Yuen2017 G
CDH4     1-0169-003chr20:
60370187-60370187
GGATGGTintronicDe novo--Yuen2017 G
CDH4     iHART2949chr20:
60499488-60499488
CAexonicMaternalstopgainNM_001252338
NM_001252339
NM_001794
c.C1614A
c.C1503A
c.C1725A
p.Y538X
p.Y501X
p.Y575X
39.0-Ruzzo2019 G
CDH4     1-0300-003chr20:
60370191-60370191
AATGGintronicDe novo--Yuen2017 G
CDH4     1-0150-003chr20:
59906665-59906665
CAintronicDe novo--Yuen2017 G
CDH4     2-1335-004chr20:
59906736-59906736
CAintronicDe novo--Yuen2017 G
CDH4     2-1366-003chr20:
60370166-60370166
GGATGGTAintronicDe novo--Yuen2017 G
CDH4     AU057404chr20:
60378768-60378768
GAintronicDe novo--Yuen2017 G
CDH4     AU2137304chr20:
59830356-59830358
TGGTGintronicDe novo--Yuen2017 G
CDH4     2-0214-004chr20:
60370191-60370191
AATGGintronicDe novo--Yuen2017 G
CDH4     AU3368303chr20:
60017333-60017333
GAintronicDe novo--Yuen2017 G
CDH4     2-0307-004chr20:
60163157-60163157
ACintronicDe novo--Yuen2017 G
CDH4     2-0149-005chr20:
59906634-59906634
CAintronicDe novo--Yuen2017 G
CDH4     2-1164-003chr20:
59930759-59930773
CTGTGTGTGTGTGTGCTGTGTGTGTGTGintronicDe novo--Yuen2017 G
CDH4     2-1231-003chr20:
59983676-59983676
GAintronicDe novo--Yuen2017 G
CDH4     1-0563-003chr20:
59906714-59906714
CAintronicDe novo--Yuen2017 G
CDH4     2-0033-003chr20:
60350429-60350429
GAintronicDe novo--Yuen2016 G
Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More