or
or
Exact

Results for "AHDC1"

Variant Events: 16

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
AHDC1     SSC10417chr1:
27877086-27877086
GAexonicDe novononsynonymous SNVNM_001029882c.C1541Tp.S514L10.462.499E-5Lim2017 E
AHDC1     SF0136425.p1chr1:
27874822-27874822
GAexonicDe novononsynonymous SNVNM_001029882c.C3805Tp.R1269W17.15-Wang2020 T
AHDC1     AU3727303chr1:
27889632-27889646
ACACGCACGCACGCAACACGCACGCAintronicDe novo--Yuen2017 G
AHDC1     SF0018463.p1chr1:
27874338-27874338
TTGexonicDe novoframeshift insertionNM_001029882c.4288dupCp.Q1430fs--Wang2020 T
AHDC1     SF0012537.p1chr1:
27877396-27877396
CTexonicDe novononsynonymous SNVNM_001029882c.G1231Ap.G411S18.03-Wang2020 T
AHDC1     SF0048552.p1chr1:
27876808-27876808
CTexonicDe novononsynonymous SNVNM_001029882c.G1819Ap.D607N21.9-Wang2020 T
AHDC1     GX0190.p1chr1:
27875353-27875353
AAGGAGGAGGAGGAGGAGGAGGexonicUnknownframeshift insertionNM_001029882c.3273_3274insCCTCCTCCTCCTCCTCCTCCp.F1092fs--Wang2020 T
AHDC1     M12434chr1:
27876625-27876625
GAexonicUnknownnonsynonymous SNVNM_001029882c.C2002Tp.R668C19.02-Wang2020 T
Wang2020 T
AHDC1     434581chr1:
27875761-27875761
GAexonicUnknownnonsynonymous SNVNM_001029882c.C2866Tp.R956C23.6-Wang2020 T
Wang2020 T
AHDC1     1-0358-003chr1:
27931220-27931221
CTCintergenicDe novo--Yuen2017 G
AHDC1     5-0077-003chr1:
27870346-27870346
CTintronicDe novo--Yuen2017 G
AHDC1     13695.p1 Complex Event; expand row to view variants  De novoframeshift insertionNM_001029882
NM_001029882
c.1758dupA
c.1757dupA
p.R587fs
p.K586fs
--Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Satterstrom2020 E
Wang2020 T
AHDC1     14191.p1chr1:
27877086-27877086
GAexonicDe novononsynonymous SNVNM_001029882c.C1541Tp.S514L10.462.499E-5Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Satterstrom2020 E
Wang2020 T
Wilfert2021 G
AHDC1     AU006804chr1:
27901050-27901050
GAintronicDe novo--Yuen2017 G
AHDC1     1-0998-003chr1:
27921194-27921208
CAGAGAGAGAGAGAGCAGAGAGAGAGAGintronicDe novo--Yuen2017 G
AHDC1     03C16906chr1:
27875296-27875296
GAexonicUnknownnonsynonymous SNVNM_001029882c.C3331Tp.R1111W17.38-Wang2020 T
Wang2020 T
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More