or
or
Exact

Results for "PPFIA2"

Variant Events: 58

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
PPFIA2     7-0397-003chr12:
81787286-81787286
CTintronicDe novo--Trost2022 G
PPFIA2     SJD_34.3chr12:
81804996-81804996
CTintronicDe novo--Trost2022 G
PPFIA2     SP0172009chr12:
81675036-81675036
CTexonicDe novononsynonymous SNVNM_001220479
NM_001220480
NM_001220477
NM_001220478
NM_001282536
NM_001220475
NM_001220473
NM_001220474
NM_001220476
NM_003625
c.G1820A
c.G770A
c.G2909A
c.G2897A
c.G2753A
c.G3149A
c.G3212A
c.G3167A
c.G3194A
c.G3212A
p.R607Q
p.R257Q
p.R970Q
p.R966Q
p.R918Q
p.R1050Q
p.R1071Q
p.R1056Q
p.R1065Q
p.R1071Q
28.4-Trost2022 G
PPFIA2     1-0186-004chr12:
81772223-81772223
CTintronicDe novo--Trost2022 G
Yuen2017 G
PPFIA2     1-0274-004chr12:
82255934-82255934
CTintergenicDe novo--Yuen2017 G
PPFIA2     MSSNG00369-003chr12:
81749809-81749809
CTintronicDe novo--Trost2022 G
PPFIA2     SP0092898chr12:
81991788-81991788
GAexonicDe novosynonymous SNVNM_001220477
NM_001220478
c.C24T
c.C24T
p.T8T
p.T8T
--Fu2022 E
Trost2022 G
Zhou2022 GE
PPFIA2     SP0129170chr12:
81655692-81655693
CTCintronicDe novo--Trost2022 G
Trost2022 G
PPFIA2     1-0606-003chr12:
81819495-81819509
ACTCTCTCTCTCTCTACTCTCTCTCTCTintronicDe novo--Yuen2017 G
PPFIA2     1-1010-003chr12:
81665767-81665767
TCintronicDe novo--Trost2022 G
PPFIA2     2-1795-003chr12:
81941258-81941258
GAintronicDe novo--Trost2022 G
PPFIA2     MSSNG00219-003chr12:
81949273-81949273
CAintronicDe novo--Trost2022 G
PPFIA2     5-0009-003chr12:
81897898-81897898
CAintronicDe novo--Trost2022 G
PPFIA2     REACH000001chr12:
81939568-81939568
ATintronicDe novo--Trost2022 G
PPFIA2     4-0034-003chr12:
81854589-81854589
CTintronicDe novo--Trost2022 G
PPFIA2     MT_151.4chr12:
81861742-81861742
TAintronicDe novo--Trost2022 G
PPFIA2     P2M7G_01chr12:
81821617-81821617
CTintronicDe novo--Trost2022 G
PPFIA2     MSSNG00380-003chr12:
81834716-81834716
CGintronicDe novo--Trost2022 G
PPFIA2     MSSNG00018-004chr12:
82079587-82079587
TCintronicDe novo--Trost2022 G
PPFIA2     4-0064-004chr12:
82109037-82109038
TTAGAintronicDe novo--Trost2022 G
PPFIA2     MSSNG00389-003chr12:
82036814-82036814
ATintronicDe novo--Trost2022 G
PPFIA2     1-1011-003chr12:
82039744-82039744
TCintronicDe novo--Trost2022 G
PPFIA2     MT_31.3chr12:
82008793-82008793
CTintronicDe novo--Trost2022 G
PPFIA2     REACH000058chr12:
82011597-82011597
TCintronicDe novo--Trost2022 G
PPFIA2     7-0383-003chr12:
81969056-81969056
GAintronicDe novo--Trost2022 G
PPFIA2     610chr12:
81974606-81974606
GTintronicDe novo--Trost2022 G
PPFIA2     AU3617302chr12:
82215797-82215797
GAintergenicDe novo--Yuen2017 G
PPFIA2     3-0607-000chr12:
82109037-82109038
TTAGAintronicDe novo--Trost2022 G
PPFIA2     AU2283301chr12:
82154003-82154003
ACupstreamDe novo--Trost2022 G
PPFIA2     2-0045-003chr12:
82307284-82307284
CAintergenicDe novo--Yuen2016 G
Yuen2017 G
PPFIA2     1-0252-003chr12:
81798488-81798488
CTintronicDe novo--Trost2022 G
Yuen2017 G
PPFIA2     AU066403chr12:
81886484-81886484
GAintronicDe novo--Trost2022 G
Yuen2017 G
PPFIA2     AU049304chr12:
81980109-81980109
AGintronicDe novo--Trost2022 G
Yuen2017 G
PPFIA2     AU4235302chr12:
82184741-82184741
GTintergenicDe novo--Yuen2017 G
PPFIA2     1-0285-004chr12:
82151423-82151423
CTintronicDe novo--Trost2022 G
Yuen2017 G
PPFIA2     AU4310301chr12:
81935547-81935547
GAintronicDe novo--Trost2022 G
Yuen2017 G
PPFIA2     2-0713-003chr12:
82165887-82165887
CGintergenicDe novo--Yuen2017 G
PPFIA2     SP0086947chr12:
81777998-81777998
GTexonicDe novostopgainNM_001220478
NM_001220477
NM_001282536
NM_001220474
NM_001220473
NM_001220475
NM_001220476
NM_003625
c.C491A
c.C566A
c.C329A
c.C734A
c.C788A
c.C788A
c.C788A
c.C788A
p.S164X
p.S189X
p.S110X
p.S245X
p.S263X
p.S263X
p.S263X
p.S263X
37.0-Antaki2022 GE
Fu2022 E
Zhou2022 GE
PPFIA2     2-0145-004chr12:
82220312-82220312
AATCintergenicDe novo--Yuen2017 G
PPFIA2     AU058103chr12:
81954643-81954643
AGintronicDe novo--Trost2022 G
Yuen2017 G
PPFIA2     AU4015301chr12:
81651348-81651348
CTdownstreamDe novo--Trost2022 G
Trost2022 G
Yuen2017 G
PPFIA2     7-0119-003chr12:
82249732-82249732
GAintergenicDe novo--Yuen2017 G
PPFIA2     AU2863302chr12:
81857394-81857394
GAintronicDe novo--Trost2022 G
Yuen2017 G
PPFIA2     AU2863302chr12:
82102717-82102719
TAATAintronicDe novo--Yuen2017 G
PPFIA2     AU3637301chr12:
82008058-82008058
CTintronicDe novo--Trost2022 G
Yuen2017 G
PPFIA2     2-1129-003chr12:
82252289-82252289
TAintergenicDe novo--Yuen2016 G
Yuen2017 G
PPFIA2     2-1689-003chr12:
81831070-81831070
GAintronicDe novo--Yuen2017 G
PPFIA2     2-1336-004chr12:
82046723-82046723
TGintronicDe novo--Trost2022 G
Yuen2017 G
PPFIA2     1-0609-003chr12:
81909735-81909735
CTintronicDe novo--Yuen2017 G
PPFIA2     AU075803chr12:
82049109-82049109
AGintronicDe novo--Trost2022 G
Yuen2017 G
PPFIA2     AU048206chr12:
81760301-81760301
ATintronicDe novo--Trost2022 G
Yuen2017 G
PPFIA2     2-1295-003chr12:
82087722-82087722
TCintronicDe novo--Yuen2017 G
PPFIA2     1-0393-003 Complex Event; expand row to view variants  De novo--Trost2022 G
Yuen2017 G
PPFIA2     2-0126-004chr12:
82144340-82144340
CGintronicDe novo--Trost2022 G
Yuen2017 G
PPFIA2     1-0393-003chr12:
81742255-81742255
GTintronicDe novo--Trost2022 G
Yuen2017 G
PPFIA2     1-0285-003chr12:
82151423-82151423
CTintronicDe novo--Trost2022 G
Yuen2017 G
PPFIA2     2-1431-003chr12:
82250813-82250813
GTintergenicDe novo--Yuen2017 G
PPFIA2     AU015903chr12:
81728552-81728552
GAintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More