or
or
Exact

Results for "TLN2"

Variant Events: 54

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
TLN2     1-0555-003chr15:
62968623-62968623
GAintronicDe novo--Trost2022 G
Yuen2017 G
TLN2     2-1629-003chr15:
63104041-63104041
CTintronicDe novo--Trost2022 G
Yuen2017 G
TLN2     AU3874302 Complex Event; expand row to view variants  De novo--Trost2022 G
Yuen2017 G
TLN2     iHART3220chr15:
63128130-63128130
CTexonicDe novononsynonymous SNVNM_015059c.C7232Tp.A2411V32.0-Ruzzo2019 G
TLN2     2-1215-003chr15:
63328520-63328529
CAGAAACTTGCintergenicDe novo--Yuen2017 G
TLN2     SP0006192chr15:
63008634-63008635
GAGexonicDe novoframeshift deletionNM_015059c.2740delAp.K914fs--Antaki2022 GE
Fu2022 E
Trost2022 G
Zhou2022 GE
TLN2     SMHC01299s000chr15:
63000827-63000827
CGexonicDe novononsynonymous SNVNM_015059c.C2299Gp.L767V13.36-Yuan2023 E
TLN2     2-1290-004chr15:
63238150-63238150
TCintergenicDe novo--Yuen2017 G
TLN2     2-0057-004chr15:
62946287-62946287
AGintronicDe novo--Trost2022 G
Yuen2017 G
TLN2     AU2292302chr15:
62952141-62952141
GAintronicDe novo--Yuen2017 G
TLN2     AU3648301chr15:
63112844-63112844
AGintronicDe novo-8.508E-6Trost2022 G
Yuen2017 G
TLN2     2-1605-003chr15:
63232686-63232686
GTintergenicDe novo--Yuen2017 G
TLN2     1-0383-003chr15:
62962954-62962954
CTintronicDe novo--Trost2022 G
Yuen2017 G
TLN2     AU4079302chr15:
63031947-63031947
GAintronicDe novo--Trost2022 G
Yuen2017 G
TLN2     78755chr15:
62948224-62948230
TTTACTCTexonicDe novononframeshift deletionNM_015059c.600_605delp.200_202del--Fu2022 E
Trost2022 G
TLN2     1-0533-003chr15:
63066810-63066810
GAintronicDe novo--Trost2022 G
Yuen2017 G
TLN2     2-1188-003chr15:
62999776-62999776
AGintronicDe novo--Trost2022 G
Yuen2017 G
TLN2     048-05-102699chr15:
63055814-63055814
CTexonicDe novononsynonymous SNVNM_015059c.C5014Tp.R1672W16.948.408E-6Fu2022 E
Satterstrom2020 E
Trost2022 G
Zhou2022 GE
TLN2     14448.p1chr15:
62948224-62948230
TTTACTCTexonicDe novononframeshift deletionNM_015059c.600_605delp.200_202del--Iossifov2014 E
Kosmicki2017 E
Satterstrom2020 E
Zhou2022 GE
TLN2     AU4079301chr15:
63261455-63261455
TCintergenicDe novo--Yuen2017 G
TLN2     AU4028302chr15:
63176494-63176494
ATintergenicDe novo--Yuen2017 G
TLN2     AU3397302chr15:
63143477-63143477
GAintergenicDe novo--Yuen2017 G
TLN2     SP0028985chr15:
63019340-63019340
AGexonicDe novononsynonymous SNVNM_015059c.A3310Gp.M1104V12.81-Fu2022 E
Trost2022 G
Zhou2022 GE
TLN2     1-0271-004chr15:
63114725-63114725
GAintronicDe novo--Trost2022 G
Yuen2017 G
TLN2     SP0146866chr15:
63012042-63012042
ATexonicDe novononsynonymous SNVNM_015059c.A2954Tp.Q985L20.4-Fu2022 E
Trost2022 G
Zhou2022 GE
TLN2     2-1153-003chr15:
63205403-63205403
AGintergenicDe novo--Yuen2016 G
Yuen2017 G
TLN2     1-0706-003chr15:
63131098-63131098
GTexonicDe novononsynonymous SNVNM_015059c.G7418Tp.R2473L23.58.237E-6Trost2022 G
Yuen2017 G
Zhou2022 GE
TLN2     1-1162-003chr15:
63016636-63016636
AGintronicDe novo--Trost2022 G
TLN2     7-0279-003chr15:
63057903-63057903
CTintronicDe novo--Trost2022 G
TLN2     1-0845-003chr15:
62990915-62990915
CTintronicDe novo-1.676E-5Trost2022 G
TLN2     AU2794301chr15:
63005783-63005783
CTintronicDe novo--Trost2022 G
TLN2     5-5123-005chr15:
62959160-62959166
ATTTCTTAintronicDe novo--Trost2022 G
TLN2     AU3903302chr15:
63128130-63128130
CTexonicDe novononsynonymous SNVNM_015059c.C7232Tp.A2411V32.0-Cirnigliaro2023 G
Trost2022 G
Yuen2017 G
Zhou2022 GE
TLN2     REACH000569chr15:
62975639-62975639
TCintronicDe novo--Trost2022 G
TLN2     AU2292301chr15:
62952141-62952141
GAintronicDe novo--Trost2022 G
Yuen2017 G
TLN2     4-0062-003chr15:
63120081-63120082
GGCTintronicDe novo--Trost2022 G
TLN2     DEASD_0337_001chr15:
63089511-63089511
GAexonicDe novosynonymous SNVNM_015059c.G6144Ap.A2048A-3.331E-5DeRubeis2014 E
Fu2022 E
Kosmicki2017 E
Lim2017 E
Satterstrom2020 E
Trost2022 G
Zhou2022 GE
TLN2     5-1009-003chr15:
63103062-63103062
CGintronicDe novo--Trost2022 G
TLN2     3-0422-000chr15:
63106688-63106688
TAintronicDe novo--Trost2022 G
TLN2     1-0826-004chr15:
63086020-63086025
CTGTTTAAAAAAAAAAAAAAintronicDe novo--Trost2022 G
TLN2     2-1546-003chr15:
63086038-63086049
ACAGACTTGAGGGGGCCGGGCGCintronicDe novo--Trost2022 G
TLN2     1-0609-003chr15:
63141372-63141374
GATGATATintergenicDe novo--Yuen2017 G
TLN2     AU3720302chr15:
63257123-63257123
TGintergenicDe novo--Yuen2017 G
TLN2     09C79752chr15:
63111781-63111781
GAexonicDe novononsynonymous SNVNM_015059c.G6838Ap.A2280T12.472.0E-4Fu2022 E
Satterstrom2020 E
Trost2022 G
Zhou2022 GE
TLN2     2-0270-003chr15:
63112519-63112519
CTintronicDe novo--Trost2022 G
Yuen2017 G
TLN2     AU2458302 Complex Event; expand row to view variants  De novo--Trost2022 G
Yuen2017 G
TLN2     12449.p1chr15:
63263805-63263805
GAintergenicDe novo--Turner2016 G
TLN2     2-1329-003chr15:
63290042-63290042
GTintergenicDe novo--Yuen2016 G
Yuen2017 G
TLN2     2-1329-003chr15:
63299909-63299909
CGintergenicDe novo--Yuen2016 G
Yuen2017 G
TLN2     G01-GEA-100-HIchr15:
63000771-63000771
GAexonicDe novononsynonymous SNVNM_015059c.G2243Ap.R748H21.9-Fu2022 E
Lim2017 E
Satterstrom2020 E
Trost2022 G
Zhou2022 GE
TLN2     12498.p1chr15:
62947291-62947291
TAintronicDe novo--Turner2016 G
TLN2     2-1329-003chr15:
63300517-63300517
ATintergenicDe novo--Yuen2016 G
Yuen2017 G
TLN2     5-0116-003chr15:
63190179-63190179
GTintergenicDe novo--Yuen2017 G
TLN2     2-0043-003chr15:
63219880-63219880
CGintergenicDe novo--Yuen2016 G
Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More