
Results for "NUDT12"

Variant Events: 69

Gene symbol on which the variant is located
Subject Identifier from the original study
Genomic location of the reference allele
Reference allele
Alternate allele
Variant functional categories
Variant validation performed by an orthogonal method and reported
Reported inheritance status
Variant effect on transcript per Annovar
Transcript used for the cDNA/Protein mutation
cDNA variant notation
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Source(s) where variants from this event are reported
NUDT12     AU045514chr5:
CTintergenicDe novo--Yuen2017 G
NUDT12     7-0273-003chr5:
CGintergenicDe novo--Yuen2017 G
NUDT12     5-0014-004chr5:
GAintergenicDe novo--Yuen2017 G
NUDT12     1-0597-003chr5:
CGintergenicDe novo--Yuen2017 G
NUDT12     2-1329-003chr5:
CTintergenicDe novo--Yuen2016 G
Yuen2017 G
NUDT12     AU2293302chr5:
TCintergenicDe novo--Yuen2017 G
NUDT12     1-0282-003chr5:
GTTTATTGTGGAGTTCATGCGintergenicDe novo--Yuen2017 G
NUDT12     AU0540301chr5:
CTintergenicDe novo--Yuen2017 G
NUDT12     AU2950301chr5:
AGintergenicDe novo--Yuen2017 G
NUDT12     AU2988302chr5:
GAintergenicDe novo--Yuen2017 G
NUDT12     AU4089302chr5:
GAintergenicDe novo--Yuen2017 G
NUDT12     2-0145-004chr5:
ATintergenicDe novo--Yuen2017 G
NUDT12     2-0323-004chr5:
GAintergenicDe novo--Yuen2017 G
NUDT12     AU4173301chr5:
AATGATAATintergenicDe novo--Yuen2017 G
NUDT12     2-1619-003chr5:
ATGTATAintergenicDe novo--Yuen2017 G
NUDT12     2-1308-003chr5:
CAintergenicDe novo--Yuen2016 G
Yuen2017 G
NUDT12     AU4412302chr5:
CTintergenicDe novo--Yuen2017 G
NUDT12     AU1988301chr5:
AGintergenicDe novo--Yuen2017 G
NUDT12     AU071804chr5:
NUDT12     AU058103chr5:
CTintergenicDe novo--Yuen2017 G
NUDT12     AU3605303chr5:
GAintergenicDe novo--Yuen2017 G
NUDT12     1-0330-003chr5:
TAintergenicDe novo--Yuen2017 G
NUDT12     1-0233-004chr5:
GTintergenicDe novo--Yuen2017 G
NUDT12     AU038204chr5:
TCintergenicDe novo--Yuen2017 G
NUDT12     AU057404chr5:
GAintergenicDe novo--Yuen2017 G
NUDT12     AU076808chr5:
TCintergenicDe novo--Yuen2017 G
NUDT12     AU017304chr5:
GAintergenicDe novo--Yuen2017 G
NUDT12     1-0044-003chr5:
TCintergenicDe novo--Yuen2017 G
NUDT12     2-1361-003chr5:
GAintergenicDe novo--Yuen2016 G
NUDT12     3-0436-000chr5:
GCintergenicDe novo--Yuen2016 G
Yuen2017 G
NUDT12     2-0063-003chr5:
GAintergenicDe novo--Yuen2017 G
NUDT12     A30chr5:
CTintergenicDe novo--Wu2018 G
NUDT12     2-1295-003chr5:
CACintergenicDe novo--Yuen2016 G
Yuen2017 G
NUDT12     1-0277-003chr5:
AGintergenicDe novo--Yuen2016 G
Yuen2017 G
NUDT12     2-1246-003chr5:
TTTTCATintergenicDe novo--Yuen2017 G
NUDT12     2-1357-004chr5:
TAintergenicDe novo--Yuen2017 G
NUDT12     AU2951303chr5:
CTintergenicDe novo--Yuen2017 G
NUDT12     AU2988303chr5:
GAintergenicDe novo--Yuen2017 G
NUDT12     2-1522-003chr5:
CGintergenicDe novo--Yuen2017 G
NUDT12     7-0012-003chr5:
CAintergenicDe novo--Yuen2017 G
NUDT12     1-0701-003chr5:
CTintergenicDe novo--Yuen2017 G
NUDT12     14223.p1chr5:
GAintronicDe novo--Satterstrom2020 E
Trost2022 G
NUDT12     AU2458302chr5:
AGintergenicDe novo--Yuen2017 G
NUDT12     2-0002-005chr5:
CTintergenicDe novo--Yuen2017 G
NUDT12     AU2951302chr5:
CTintergenicDe novo--Yuen2017 G
NUDT12     AU3891303chr5:
CTintergenicDe novo--Yuen2017 G
NUDT12     1-0246-005chr5:
GAintergenicDe novo--Yuen2017 G
NUDT12     AU3727302chr5:
TGintergenicDe novo--Yuen2017 G
NUDT12     1-0359-003chr5:
TCintergenicDe novo--Yuen2017 G
NUDT12     1-0526-003chr5:
GGATintergenicDe novo--Yuen2017 G
NUDT12     1-0022-004chr5:
GAintergenicDe novo--Yuen2017 G
NUDT12     1-0079-008chr5:
CTintergenicDe novo--Yuen2017 G
NUDT12     AU066818chr5:
CAintergenicDe novo--Yuen2017 G
NUDT12     2-1267-003chr5:
CCTATintergenicDe novo--Yuen2017 G
NUDT12     7-0148-003chr5:
GAintergenicDe novo--Yuen2017 G
NUDT12     2-0289-003chr5:
CTintergenicDe novo--Yuen2017 G
NUDT12     2-0244-003chr5:
GCintergenicDe novo--Yuen2017 G
NUDT12     2-1005-003chr5:
ATintergenicDe novo--Yuen2017 G
NUDT12     2-1153-003chr5:
CAintergenicDe novo--Yuen2016 G
Yuen2017 G
NUDT12     AU1995302chr5:
CGintergenicDe novo--Yuen2017 G
NUDT12     1-0552-003chr5:
ACintergenicDe novo--Yuen2017 G
NUDT12     2-1353-003chr5:
CTintergenicDe novo--Yuen2016 G
Yuen2017 G
NUDT12     1-0593-003chr5:
CTintergenicDe novo--Yuen2017 G
NUDT12     SP0105000chr5:
CTexonicDe novononsynonymous SNVNM_001300741
15.82-Fu2022 E
Trost2022 G
Zhou2022 GE
NUDT12     mAGRE4577chr5:
ACTTTAexonicPaternalframeshift deletionNM_001300741
-8.953E-6Cirnigliaro2023 G
NUDT12     AU3865301chr5:
TCintergenicDe novo--Yuen2017 G
NUDT12     AU3997302chr5:
AGATCTGTGAAGAintergenicDe novo--Yuen2017 G
NUDT12     mAGRE4576chr5:
ACTTTAexonicPaternalframeshift deletionNM_001300741
-8.953E-6Cirnigliaro2023 G
NUDT12     AU058104chr5:
GAintergenicDe novo--Yuen2017 G
Source Variant Information

, -


Paper alias:

No records found.
Paper Information
Variant source
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView