or
or
Exact

Results for "SEMA6D"

Variant Events: 55

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
SEMA6D     2-1341-003chr15:
47941543-47941543
GCintronicDe novo--Trost2022 G
Yuen2017 G
SEMA6D     AU2381302chr15:
47882723-47882741
TAATAAATAAATAAATAAATAATAAATAAATAAAintronicDe novo--Yuen2017 G
SEMA6D     1-0569-003 Complex Event; expand row to view variants  De novo--Trost2022 G
Yuen2017 G
SEMA6D     1-0699-003chr15:
47988251-47988251
AGintronicDe novo--Trost2022 G
Yuen2017 G
SEMA6D     MSSNG00342-003chr15:
47565382-47565382
TCintronicDe novo--Trost2022 G
SEMA6D     3-0800-000chr15:
47569173-47569173
CTintronicDe novo--Trost2022 G
SEMA6D     AU1725306chr15:
47881794-47881794
AGintronicDe novo--Trost2022 G
Yuen2017 G
SEMA6D     2-1528-003chr15:
47531603-47531603
CTintronicDe novo--Trost2022 G
SEMA6D     2-1287-003chr15:
47541214-47541216
CAGCintronicDe novo--Trost2022 G
SEMA6D     3-0484-000chr15:
47507325-47507328
ACAACTCCTCCCintronicDe novo--Trost2022 G
SEMA6D     MSSNG00394-003chr15:
47521073-47521073
TGintronicDe novo--Trost2022 G
SEMA6D     MSSNG00432-003chr15:
47477697-47477697
CTintronicDe novo--Trost2022 G
SEMA6D     1-0303-003chr15:
47829879-47829881
TTTAAAAAAAAintronicDe novo--Trost2022 G
SEMA6D     1-1226-003chr15:
47844409-47844409
AGintronicDe novo--Trost2022 G
SEMA6D     MSSNG00415-003chr15:
47717986-47717986
ACintronicDe novo--Trost2022 G
SEMA6D     10-1104-004chr15:
47750536-47750540
TAAACTintronicDe novo--Trost2022 G
SEMA6D     REACH000349chr15:
47638845-47638845
CTintronicDe novo--Trost2022 G
SEMA6D     1-1049-003chr15:
47708337-47708341
GATACGintronicDe novo--Trost2022 G
SEMA6D     AU2787301chr15:
47636894-47636894
AGintronicDe novo--Trost2022 G
Yuen2017 G
SEMA6D     1-0098-003Achr15:
47576910-47576910
AGintronicDe novo--Trost2022 G
SEMA6D     5-0009-003chr15:
47637131-47637131
ACintronicDe novo--Trost2022 G
SEMA6D     4-0062-003chr15:
47952533-47952535
TGAAATintronicDe novo--Trost2022 G
SEMA6D     4-0081-003chr15:
47987277-47987277
AGintronicDe novo--Trost2022 G
SEMA6D     MSSNG00020-004chr15:
47930148-47930148
CAintronicDe novo--Trost2022 G
SEMA6D     REACH000073chr15:
47949447-47949453
GTTAAAAGintronicDe novo--Trost2022 G
SEMA6D     REACH000097chr15:
47880614-47880614
CTintronicDe novo--Trost2022 G
SEMA6D     7-0286-004Achr15:
47914248-47914248
GTintronicDe novo--Trost2022 G
SEMA6D     3-0031-000chr15:
47857638-47857638
GAintronicDe novo--Trost2022 G
SEMA6D     5-5231-003chr15:
47872869-47872869
TGintronicDe novo--Trost2022 G
SEMA6D     2-0202-003chr15:
47859711-47859711
CTintronicDe novo--Trost2022 G
Yuen2017 G
SEMA6D     SP0166902chr15:
48054447-48054447
GAexonicDe novononsynonymous SNVNM_020858
NM_024966
NM_153616
NM_153617
NM_153618
NM_153619
NM_001198999
c.G589A
c.G589A
c.G589A
c.G589A
c.G589A
c.G589A
c.G589A
p.V197I
p.V197I
p.V197I
p.V197I
p.V197I
p.V197I
p.V197I
37.0-Trost2022 G
SEMA6D     SP0129913chr15:
48063045-48063045
GAexonicDe novononsynonymous SNVNM_020858
NM_153616
NM_153617
NM_153618
NM_001198999
c.G2099A
c.G2060A
c.G2117A
c.G2285A
c.G2099A
p.R700Q
p.R687Q
p.R706Q
p.R762Q
p.R700Q
9.6767.0E-4Trost2022 G
SEMA6D     MSSNG00421-007chr15:
48014653-48014653
GAintronicDe novo--Trost2022 G
SEMA6D     AU3680302chr15:
47796333-47796333
CTintronicDe novo--Trost2022 G
Yuen2017 G
SEMA6D     4-0073-003chr15:
48027100-48027100
GCintronicDe novo--Trost2022 G
SEMA6D     AU4473301chr15:
47875555-47875555
TAintronicDe novo--Yuen2017 G
SEMA6D     mAGRE5409chr15:
48063885-48063885
TTAAAGAGGACGCCGTCCTTAAAACCTGACGTGCCACCAexonicPaternalframeshift insertionNM_020858
NM_153616
NM_153617
NM_153618
NM_001198999
c.2939_2940insAAAGAGGACGCCGTCCTTAAAACCTGACGTGCCACCA
c.2900_2901insAAAGAGGACGCCGTCCTTAAAACCTGACGTGCCACCA
c.2957_2958insAAAGAGGACGCCGTCCTTAAAACCTGACGTGCCACCA
c.3125_3126insAAAGAGGACGCCGTCCTTAAAACCTGACGTGCCACCA
c.2939_2940insAAAGAGGACGCCGTCCTTAAAACCTGACGTGCCACCA
p.L980fs
p.L967fs
p.L986fs
p.L1042fs
p.L980fs
--Cirnigliaro2023 G
SEMA6D     1-0289-004chr15:
47633849-47633849
ATintronicDe novo--Yuen2017 G
SEMA6D     mAGRE4927chr15:
48058380-48058380
GCsplicingMaternalsplicing17.32-Cirnigliaro2023 G
SEMA6D     2-0286-004chr15:
47546359-47546359
AGintronicDe novo--Trost2022 G
Yuen2017 G
SEMA6D     NDAR_INVNE346GDX_wes1chr15:
48056548-48056548
CTintronicDe novo-1.802E-5Fu2022 E
Kosmicki2017 E
Satterstrom2020 E
Trost2022 G
SEMA6D     AU3846303chr15:
47753370-47753370
GAintronicDe novo--Yuen2017 G
SEMA6D     7-0222-003chr15:
48089209-48089209
AGintergenicDe novo--Yuen2017 G
SEMA6D     AU1223301chr15:
47684745-47684745
AGintronicDe novo--Yuen2017 G
SEMA6D     5-0138-003chr15:
47695179-47695179
GAintronicDe novo--Trost2022 G
Yuen2017 G
SEMA6D     GM181996chr15:
48058666-48058666
AGintronicDe novo--Fu2022 E
SEMA6D     A20chr15:
47958436-47958436
GAintronicDe novo--Wu2018 G
SEMA6D     GM171511chr15:
48053424-48053424
GCintronicDe novo--Fu2022 E
SEMA6D     1-0150-003chr15:
47591799-47591799
AGintronicDe novo--Trost2022 G
Yuen2017 G
SEMA6D     13298.p1chr15:
47655934-47655934
GAintronicDe novo--Turner2016 G
SEMA6D     2-1341-004chr15:
47683666-47683666
ACintronicDe novo--Trost2022 G
Yuen2017 G
SEMA6D     2-1164-003chr15:
47726238-47726238
AGintronicDe novo--Trost2022 G
Yuen2016 G
Yuen2017 G
SEMA6D     2-1105-003chr15:
47859363-47859363
TCintronicDe novo--Trost2022 G
Yuen2016 G
Yuen2017 G
SEMA6D     1-0874-003chr15:
47965700-47965700
GCintronicDe novo--Trost2022 G
Yuen2017 G
SEMA6D     AU3861303 Complex Event; expand row to view variants  De novo--Trost2022 G
Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More